ORFeome > rpl30 ORF1 – XORFeome v1.0

rpl30 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl30
Gene ID: 6253786
Gene Page ID: 6457558
ORF Xenbase ID: 17294259

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053758
Original XGC clone length: 351

Human orthology & disease relationships

NCBI Entrez ID: 6156
Ensembl gene IDs: ENSG00000156482
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,180105,603896,608688

Library Location

Plate ID: GDExl11001
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ839212
dbEST ID: 79656914
Trimmed Sequence: ATGGTGGCCGCCAAGAAGACGAAAAAGTCTTTGGAGTCTATCAACTCTAGGCTTCAGCTGGTGATGAAAAGTGGCAAATATGTCCTGGGATATAAGCAGACCTTGAAAATGATCCGACAGGGCAAAGCTAAGCTGGTTATACTTGCCAACAACTGCCCAGCTCTGAGGAAATCCGAGATTGAGTACTATGCAATGTTGGCAAAGACTGGTGTGCACCACTACAGCGGCAACAACATTGAATTGGGTACAGCCTGCGGAAAGTACTACAGAGTATGCACACTGGCTATTATTGATCCAGGTGATTCAGACATCATCAGAAGCATGCCAGAGCAACAGGCCATTGAGAAATT
Full Trace Sequence: GAGATTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGCCGCCAAGAAGACGAAAAAGTCTTTGGAGTCTATCAACTCTAGGCTTCAGCTGGTGATGAAAAGTGGCAAATATGTCCTGGGATATAAGCAGACCTTGAAAATGATCCGACAGGGCAAAGCTAAGCTGGTTATACTTGCCAACAACTGCCCAGCTCTGAGGAAATCCGAGATTGAGTACTATGCAATGTTGGCAAAGACTGGTGTGCACCACTACAGCGGCAACAACATTGAATTGGGTACAGCCTGCGGAAAGTACTACAGAGTATGCACACTGGCTATTATTGATCCAGGTGATTCAGACATCATCAGAAGCATGCCAGAGCAACAGGCCATTGAGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCAAGAACATGTCTCAAAATCCCTATATGTTACAGTTCGGGCCTGGCCGGGGCGGNTTGGCTCGATTGCACATAAAACAAAGGTGGCCAGGTGAATTTCCTCTGTGTATACCGGTTAAAGGCCCACACGGGTAAGGAATAACCTTGCTCGGCTCTGATCTCAAACTTGGGTGGTGCCGGGCGCCACCCGGCGACGTGTGCAAAAACTTTGAAACAAAGACCAAAGGGGTCCCGGGAGGAAAGAGGGGTTTTTTCTGGGTGTTTTGTAAAATTTTTTTTTAGAGAGGGAAGAAATCTTCCCGCCTCGGGCCCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGCCGCCAAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839211
dbEST ID: 79656913
Trimmed Sequence: TTTCTCAATGGCCTGTTGCTCTGGCATGCTTCTGATGATGTCTGAATCACCTGGATCAATAATAGCCAGTGTGCATACTCTGTAGTACTTTCCGCAGGCTGTACCCAATTCAATGTTGTTGCCGCTGTAGTGGTGCACACCAGTCTTTGCCAACATTGCATAGTACTCAATCTCGGATTTCCTCAGAGCTGGGCAGTTGTTGGCAAGTATAACCAGCTTAGCTTTGCCCTGTCGGATCATTTTCAAGGTCTGCTTATATCCCAGGACATATTTGCCACTTTTCATCACCAGCTGAAGCCTAGAGTTGATATACTCCAAAGACTTTTTCGTCTTCTTGGCGGCCACCATGG
Full Trace Sequence: GGCGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCNACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTCAATGGCCTGTTGCTCTGGCATGCTTCTGATGATGTCTGAATCACCTGGATCAATAATAGCCAGTGTGCATACTCTGTAGTACTTTCCGCAGGCTGTACCCAATTCAATGTTGTTGCCGCTGTAGTGGTGCACACCAGTCTTTGCCAACATTGCATAGTACTCAATCTCGGATTTCCTCAGAGCTGGGCAGTTGTTGGCAAGTATAACCAGCTTAGCTTTGCCCTGTCGGATCATTTTCAAGGTCTGCTTATATCCCAGGACATATTTGCCACTTTTCATCACCAGCTGAAGCCTAGAGTTGATATACTCCAAAGACTTTTTCGTCTTCTTGGCGGCCACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCACCGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGGATCTAAAAACGAAACGTCATTAATAACATAAGAGACATAGCTGTTTACGTGTCAGCTCTGGCACGTGTCAAAAAATAAATAAATATACAAAATAGAGATTTACTTGTATAAAGGGGAAGCCCCCCNNCCCAAAAAAAAAAAACCAAGGCCCGCCCAAACCAAATGTGTTGGCTGCCCCTTCCTTCTTGGAGTGAGGANTGGNNNNNAAACCCCCCCTCGNAAAAGAAAAAAAAACCNCCTCCCGACGNNGAAGAGTAATAAATTTTTTNTAANNTTNGANAACACGGCCCCCCCCANCCCGAACGGGGTAGANGNAGNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTCAATGGCCTGTTGCT