ORFeome > rpl37a ORF1 – XORFeome v1.0

rpl37a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl37a
Gene ID: 5811806
Gene Page ID: 5811554
ORF Xenbase ID: 17294325

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053766
Original XGC clone length: 279

Human orthology & disease relationships

NCBI Entrez ID: 6168
Ensembl gene IDs: ENSG00000197756
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11001
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ839196
dbEST ID: 79656898
Trimmed Sequence: ATGGCCAAGCGCACCAAGAAGGTTGGCATTGTGGGTAAATATGGGACCCGTTTCGGTGCTTCCTTGAGGAAGATGGTCAAAAAGATTGAAATCAGCCAGCATGCCAAATACACCTGCTCCTTCTGTGGCAAGACCAAGATGAAGAGAAAGGCTGTTGGAATCTGGCACTGTGGATCTTGCATGAAAATTGTAGCTGGAGGAGCCTGGACCTACAACACCACCTCCGCTGTCACAGTCAAATCTGCTATCAGAAGACTGAAGGAACTGAAAGACCAGTT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAAGCGCACCAAGAAGGTTGGCATTGTGGGTAAATATGGGACCCGTTTCGGTGCTTCCTTGAGGAAGATGGTCAAAAAGATTGAAATCAGCCAGCATGCCAAATACACCTGCTCCTTCTGTGGCAAGACCAAGATGAAGAGAAAGGCTGTTGGAATCTGGCACTGTGGATCTTGCATGAAAATTGTAGCTGGAGGAGCCTGGACCTACAACACCACCTCCGCTGTCACAGTCAAATCTGCTATCAGAAGACTGAAGGAACTGAAAGACCAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTAAAACCCGTGTCTCAAAATCTCTGATGTTACAAGGNNNTGCNGGGGGTNNGGNAAAAAAGAATCCCTCGAACAACGGGGCCCTGGGTCCTCTTGGGTTGACGGGAAAACCCCCCGCCCTGGACATTCCCCGGGGACGGGGGTAAAGGGTGTGAACAAACGCGTGGGAAGCGCAATTGAGGCCAAAACCCGCCAGAAAACGATGGGGGGAGGGGGGAGGTGGCGTTTTTTGGGGGGGTTAATAGATTTATTTTAGGGGCCCCCCCACACACGCGGCCTCAAACACACCACACGCCATACCCGCGGGGGGGGGGGTTAGATGAGGCGGCAGCACAGAGCAGTGTTTTCTATACATGAGGGTTAAGCAACAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAAGCGCACCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839195
dbEST ID: 79656897
Trimmed Sequence: CTGGTCTTTCAGTTCCTTCAGTCTTCTGATAGCAGATTTGACTGTGACAGCGGAGGTGGTGTTGTAGGTCCAGGCTCCTCCAGCTACAATTTTCATGCAAGATCCACAGTGCCAGATTCCAACAGCCTTTCTCTTCATCTTGGTCTTGCCACAGAAGGAGCAGGTGTATTTGGCATGCTGGCTGATTTCAATCTTTTTGACCATCTTCCTCAAGGAAGCACCGAAACGGGTCCCATATTTACCCACAATGCCAACCTTCTTGGTGCGCTTGGCCATGG
Full Trace Sequence: CGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGTCTTTCAGTTCCTTCAGTCTTCTGATAGCAGATTTGACTGTGACAGCGGAGGTGGTGTTGTAGGTCCAGGCTCCTCCAGCTACAATTTTCATGCAAGATCCACAGTGCCAGATTCCAACAGCCTTTCTCTTCATCTTGGTCTTGCCACAGAAGGAGCAGGTGTATTTGGCATGCTGGCTGATTTCAATCTTTTTGACCATCTTCCTCAAGGAAGCACCGAAACGGGTCCCATATTTACCCACAATGCCAACCTTCTTGGTGCGCTTGGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTAGAAAGCATTTTACAACGTCTAAACAGGGAGCTGAAACGCCGCGGGGAAAAAAAGCAAAAGGTCCCTTCAAAAAAAGTGGCTGGGGGATGTCAGCTGGGGACGGGAAAAGGCCCAACAACGGGGACAACCAGGTGGCGGCTTTAAATGTTGGAAATTAGGTAGGGGGGCCGCCCGGGACGCAAAACTAAGAAAACCGCGGGGGGGGAAGGGGAGGGGGGGAGGTGGGGGGGGGAGGGGAGGGTTGGAGNTGGGGGGGTAGGGGNTGAGANGGCGAANGAGAAGAGGAAGAGTGGGGGGAGGAAGGGGAGGTAATTGNAAGANAAANGATAAGGGAGGGAGGGAAGGAGGTTTGATGTGTGAATAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGTCTTTCAGTTCCTTCAGT