ORFeome > rrm2.1 ORF2 – XORFeome v1.0

rrm2.1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rrm2.1
Gene ID: 947057
Gene Page ID: 947051
ORF Xenbase ID: 17294793

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106682
Original XGC clone length: 1221

Human orthology & disease relationships

NCBI Entrez ID: 6241
Ensembl gene IDs: ENSG00000171848
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,137215,155255,192430,223100,307030,500003,551500,603903,607822,608089

Library Location

Plate ID: GDExl11083
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ837198
dbEST ID: 79654900
Trimmed Sequence: ATGTTGTCTCCTCGCAACGCGCTCAGTCCGCTAAAGGAGAACGTGTCTCCCATGAAGAGAATGGTCCTGTCAGATAAAGAGAACACTGTAGGTTCAGCCGAGCTATTAGTCAGGCAAACATGGCGGTGTACAGAGCAGACTCTCACTTGTTCCTCTTTCTGTCGCTTCCAGCCCCCTAACGTAAACTCCGACAGGATCTCCCGGGGAACACAGAAAGAACTGGTCTGTCAGAGCGTAAAGGATCCTCTGATACAGGATGAGCCTCTCCTGAGGGACAACCCAGGCCGCTTTGTGATCCTGCCTATTGAGTATCATGACATATGGCAGATGTACAAGAAGGCAGAGGCTTCTTTCTGGACGGCAGAAGAGGTGGATCTTTCTAAAGATCTTCAGCACTGGGAAACTTTAAAGCCTGAAGAAAGATACTTCATTTCTTATGTGTTGGCCTTTTTTGCAGCAAGCGATGGGATTGTTAATGAGAATCTGGTGGAGCGCTTCAGCCAGGAAGTGCAAGTAACCGAGGTTCGCTGCTTTTATGGTTTTCAAATTGCAATGGAGAACATTCATTCTGAAATGTACAGTCTTCTGATTGACACATATATTAAAGATCCCCAGGGAAAGGGAGTTCCTCTTCAATGCAATAGAAACCTTGACCTTGTGTTAAAAAAAAAGCAGAAAGGGTCCCCGGCGTTTGATAAATGACCAAAGAAAGCACCTTAATTGTGAAC
Full Trace Sequence: GGCCCCCAATAATGGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGTCTCCTCGCAACGCGCTCAGTCCGCTAAAGGAGAACGTGTCTCCCATGAAGAGAATGGTCCTGTCAGATAAAGAGAACACTGTAGGTTCAGCCGAGCTATTAGTCAGGCAAACATGGCGGTGTACAGAGCAGACTCTCACTTGTTCCTCTTTCTGTCGCTTCCAGCCCCCTAACGTAAACTCCGACAGGATCTCCCGGGGAACACAGAAAGAACTGGTCTGTCAGAGCGTAAAGGATCCTCTGATACAGGATGAGCCTCTCCTGAGGGACAACCCAGGCCGCTTTGTGATCCTGCCTATTGAGTATCATGACATATGGCAGATGTACAAGAAGGCAGAGGCTTCTTTCTGGACGGCAGAAGAGGTGGATCTTTCTAAAGATCTTCAGCACTGGGAAACTTTAAAGCCTGAAGAAAGATACTTCATTTCTTATGTGTTGGCCTTTTTTGCAGCAAGCGATGGGATTGTTAATGAGAATCTGGTGGAGCGCTTCAGCCAGGAAGTGCAAGTAACCGAGGTTCGCTGCTTTTATGGTTTTCAAATTGCAATGGAGAACATTCATTCTGAAATGTACAGTCTTCTGATTGACACATATATTAAAGATCCCCAGGGAAAGGGAGTTCCTCTTCAATGCAATAGAAACCTTGACCTTGTGTTAAAAAAAAAGCAGAAAGGGTCCCCGGCGTTTGATAAATGACCAAAGAAAGCACCTTAATTGTGAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGTCTCCTCGCAACGCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837197
dbEST ID: 79654899
Trimmed Sequence: AAAGTCAGCATTTAGAGTGAATTGGTTTTCCGTGGCCTTGGCCATGACACCCATCTTCTGGTATTCACCAACTTTCTTCTCAAAGAAATTGGTCTTTCCTTCTAAGGAGATGTTTTCCATGAAGTCAAATGGATTCTCAGACTTAAAAATCTTTTTAAAACCAAGCTCCAGCAGAAGCCGATCTGCTACAAATTCAATATACTGCTTCATCAGTGTGCAGTTCATACCAATTAGCTCCACAGGTAGAGCTTCAATCAAGAATTCCTGCTCAATCTTGACCGCATCAATGATAATTTCCCTGACACGTTGCTCTGAGGGTTTGTGTACAACATGTTTAAACAAAAGGCGAGCAAAGTCAGTGTGCAAACCTTCATCTCTGCTAATAAGTTCGTTAGAGAAAGTGAGTCCAGGCATCAGCCCTCGTTTCTTCAGCCAGAATATGGAAGCAAATGAACCACAGAAGAATATCCCTTCAACAGCAGCGAAGGGGACAAGGCGCTCACAATAAGGTGCTTCTCTGTCTCTTATCCCACACGGGGAGCGTTCTGCGTTCTTTTTAGCACAAGCGCAGCGGGGCGGTTGCGTTTGAGAATGAACTGCCGTTTCCTTGTGATGGGGTGAGATAAATTTTCATCGGGAA
Full Trace Sequence: GGGCAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGTCAGCATTTAGAGTGAATTGGTTTTCCGTGGCCTTGGCCATGACACCCATCTTCTGGTATTCACCAACTTTCTTCTCAAAGAAATTGGTCTTTCCTTCTAAGGAGATGTTTTCCATGAAGTCAAATGGATTCTCAGACTTAAAAATCTTTTTAAAACCAAGCTCCAGCAGAAGCCGATCTGCTACAAATTCAATATACTGCTTCATCAGTGTGCAGTTCATACCAATTAGCTCCACAGGTAGAGCTTCAATCAAGAATTCCTGCTCAATCTTGACCGCATCAATGATAATTTCCCTGACACGTTGCTCTGAGGGTTTGTGTACAACATGTTTAAACAAAAGGCGAGCAAAGTCAGTGTGCAAACCTTCATCTCTGCTAATAAGTTCGTTAGAGAAAGTGAGTCCAGGCATCAGCCCTCGTTTCTTCAGCCAGAATATGGAAGCAAATGAACCACAGAAGAATATCCCTTCAACAGCAGCGAAGGGGACAAGGCGCTCACAATAAGGTGCTTCTCTGTCTCTTATCCCACACGGGGAGCGTTCTGCGTTCTTTTTAGCACAAGCGCAGCGGGGCGGTTGCGTTTGAGAATGAACTGCCGTTTCCTTGTGATGGGGTGAGATAAATTTTCATCGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGTCAGCATTTAGAGTGAATTG