ORFeome > rwdd2a ORF1 – XORFeome v1.0

rwdd2a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rwdd2a
Gene ID: 945828
Gene Page ID: 945824
ORF Xenbase ID: 17294997

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082686
Original XGC clone length: 867

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ839596
dbEST ID: 79657298
Trimmed Sequence: ATGGCCACTACAACAAGAGAATGTCTGGAACTTCAGCTTTTAGAGATGGAGATGCTTTTGTCAATGTTTCCTAACAAAGAACTTATTCTGGAGAATGCAAATTCTGTTTTGTATATACGTAGATATCTAGAGGGAATTCGTGAATCATTACCTCCTGTTATTGAATTTTCAGTTTTCCTTAACATTCAGAATTCTGAGGTAAAGGCAGTGATGCACGTGTCACTACCTCAAAGTTACCCTCAAGAAGAACCCCAGGTATTTGTTAGGTCAGTGGCACTAGACAGGCAACAGCAAAACTTTCTAAACAAAGAACTAGGGTCCTATATCCGTTCCTTAGATCGAGGGGAGCTGTGCATCTCAATGGCAGTTCAGTGGCTGCAGGACAACATCTCCACTTACATACAGAACTCTAAGCAGAATGATGAACCTGAATGTGAAATAAAGGCAACCACATACACATTTCATCGCATGTGGATCTATAGCCACCACATATACCGCCAGGAATTACGAAAGAAGATCTTAGACTATGCCAAGAGACTAAACTTGACAGGATTCTGTTTGACAGGAAAGCCTGGTGTCATTTGTATAGAAGGTGTAAAGGAGCAATGTGAGGAATTCTGGCGTGACATCCGCTATCCAAACTGGAAACATATATCGTGCAAACACACAGAGAGCAAAGAAGTGACTGGGGAAAATAGACGAACCTGCGGCTGTTTAATTCTTTGGGAAGAGCTGGTGGTTACTGCTCATGGAGAATATTGGACTTAGGGAATGACTTATCAAATGGGACCCTGGAAACAATTTCCGGGAAGTATCTTTAAAACAGCCATAA
Full Trace Sequence: CGTGGCCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCACTACAACAAGAGAATGTCTGGAACTTCAGCTTTTAGAGATGGAGATGCTTTTGTCAATGTTTCCTAACAAAGAACTTATTCTGGAGAATGCAAATTCTGTTTTGTATATACGTAGATATCTAGAGGGAATTCGTGAATCATTACCTCCTGTTATTGAATTTTCAGTTTTCCTTAACATTCAGAATTCTGAGGTAAAGGCAGTGATGCACGTGTCACTACCTCAAAGTTACCCTCAAGAAGAACCCCAGGTATTTGTTAGGTCAGTGGCACTAGACAGGCAACAGCAAAACTTTCTAAACAAAGAACTAGGGTCCTATATCCGTTCCTTAGATCGAGGGGAGCTGTGCATCTCAATGGCAGTTCAGTGGCTGCAGGACAACATCTCCACTTACATACAGAACTCTAAGCAGAATGATGAACCTGAATGTGAAATAAAGGCAACCACATACACATTTCATCGCATGTGGATCTATAGCCACCACATATACCGCCAGGAATTACGAAAGAAGATCTTAGACTATGCCAAGAGACTAAACTTGACAGGATTCTGTTTGACAGGAAAGCCTGGTGTCATTTGTATAGAAGGTGTAAAGGAGCAATGTGAGGAATTCTGGCGTGACATCCGCTATCCAAACTGGAAACATATATCGTGCAAACACACAGAGAGCAAAGAAGTGACTGGGGAAAATAGACGAACCTGCGGCTGTTTAATTCTTTGGGAAGAGCTGGTGGTTACTGCTCATGGAGAATATTGGACTTAGGGAATGACTTATCAAATGGGACCCTGGAAACAATTTCCGGGAAGTATCTTTAAAACAGCCATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACTACAACAAGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839595
dbEST ID: 79657297
Trimmed Sequence: GTATTTCCCTTCAATGCCAAATAATATCTGGAATATATGTTCGCAGTTATGCTGTTTGAGATACTCCAGAAATTGTCCAAGGTCCATATGATAGTCATTCCTAAGTCCATAATCTCCATGAGCAGTAAACACCAGCTCTTCAAAAGAATTAAACAGCCGCAGGTCGTCTATTTTCCCAGTCACTTCTTTGCTCTCTGTGTGTTTGCACGATATATGTTTCCAGTTTGGATAGCGGATGTCACGCCAGAATTCCTCACATTGCTCCTTTACACCTTCTATACAAATGACACCAGGCTTTCCTGTCAAACAGAATCCTGTCAAGTTTAGTCTCTTGGCATAGTCTAAGATCTTCTTTCGTAATTCCTGGCGGTATATGTGGTGGCTATAGATCCACATGCGATGAAATGTGTATGTGGTTGCCTTTATTTCACATTCAGGTTCATCATTCTGCTTAGAGTTCTGTATGTAAGTGGAGATGTTGTCCTGCAGCCACTGAACTGCCATTGAGATGCACAGCTCCCCTCGATCTAAGGAACGGATATAGGACCCTAGTTCTTTGTTTAGAAAGTTTTGCTGTTGCCTGTCTAGTGCCACTGACCTAACAAATACCTGGGGTTTCTCTTGAGGGTACTTTGAAGTAATGACACGTGCCTTACTGCCCTTTACCTAAAAATCCTAAATGTAAGGGAAAAACGGAAAATTCAAAAACGGGGAGGTTAATGATTCAAGAAAATTCCCTTTTGAAATTTCCCCCTTAAATTTCCAAAACGA
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTATTTCCCTTCAATGCCAAATAATATCTGGAATATATGTTCGCAGTTATGCTGTTTGAGATACTCCAGAAATTGTCCAAGGTCCATATGATAGTCATTCCTAAGTCCATAATCTCCATGAGCAGTAAACACCAGCTCTTCAAAAGAATTAAACAGCCGCAGGTCGTCTATTTTCCCAGTCACTTCTTTGCTCTCTGTGTGTTTGCACGATATATGTTTCCAGTTTGGATAGCGGATGTCACGCCAGAATTCCTCACATTGCTCCTTTACACCTTCTATACAAATGACACCAGGCTTTCCTGTCAAACAGAATCCTGTCAAGTTTAGTCTCTTGGCATAGTCTAAGATCTTCTTTCGTAATTCCTGGCGGTATATGTGGTGGCTATAGATCCACATGCGATGAAATGTGTATGTGGTTGCCTTTATTTCACATTCAGGTTCATCATTCTGCTTAGAGTTCTGTATGTAAGTGGAGATGTTGTCCTGCAGCCACTGAACTGCCATTGAGATGCACAGCTCCCCTCGATCTAAGGAACGGATATAGGACCCTAGTTCTTTGTTTAGAAAGTTTTGCTGTTGCCTGTCTAGTGCCACTGACCTAACAAATACCTGGGGTTTCTCTTGAGGGTACTTTGAAGTAATGACACGTGCCTTACTGCCCTTTACCTAAAAATCCTAAATGTAAGGGAAAAACGGAAAATTCAAAAACGGGGAGGTTAATGATTCAAGAAAATTCCCTTTTGAAATTTCCCCCTTAAATTTCCAAAACGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATTTCCCTTCAATGCCAAATAA