ORFeome > scgn ORF1 – XORFeome v1.0

scgn ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: scgn
Gene ID: 988349
Gene Page ID: 988343
ORF Xenbase ID: 17295327

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC082920
Original XGC clone length: 816

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ839769
dbEST ID: 79657471
Trimmed Sequence: ATGGACAGCGCCTTCCTGAAACTGGACGCAGCCGAGTTCTTGGAGATCTGGCAGCGCTTTGATGCTGATGACAATGGCTACATTGAGGGCAAGGAGTTGGATGAATTCTTTTGCCATCTGCTTAAGAAACTGGGCACAAATGCAATAACAGCTGATAAGGTTCAGGGGGTGAAAGATCGATTTATGTCTGCGTATGACATTACCGCTGATGGACGTCTACAAATACAAGAGCTTGCAAACATGATTCTGCCTGAAGATGAAAATTTTCTGTTGCTGTTTCGCCGAGAAACTCCATTGGATAACAGCGTGGAGTTCATGCGGATTTGGAGGAAATTTGATGAGGATAGCAGTGGATTTATCTCAGCAGTTGAACTCAGGAATTTCTTGCAAGATCTGTTCTTACAGCACAAGAAACATATTACAGGTGACAAGCTGGATGAATATACAGACACCATGATGAAACTGTTCAACAGAAATAAAGATGGACGGCTAGACCTGAATGACTTGGCAAAGATCCTGGCTCTGCAAGAAAATTTCCTTCTTCAATTCAAAATGGATGCAAGTAGCCAAGAGGAAAGAAAGAGCGACTTTGAAACTATCTTTGCGCACTATGATGTTAGTAAAACAGGAGCATTAGAGGGGTCCAGAAGTGAACGGATTTGTCAAAGATATGATGGAACTTTGTGAAGCAAGCATCAATTGGTGTTGAACTCGATAAAATTCCGTCAAATCCCATTAAACCCTTTGTAATTTTCAACAAAGGATGGGGAAAAATCCAAAAATTCCTAAACTGGCCCCTTGGGGCCTGTGCTCTAAAAAAC
Full Trace Sequence: CTCGAGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACAGCGCCTTCCTGAAACTGGACGCAGCCGAGTTCTTGGAGATCTGGCAGCGCTTTGATGCTGATGACAATGGCTACATTGAGGGCAAGGAGTTGGATGAATTCTTTTGCCATCTGCTTAAGAAACTGGGCACAAATGCAATAACAGCTGATAAGGTTCAGGGGGTGAAAGATCGATTTATGTCTGCGTATGACATTACCGCTGATGGACGTCTACAAATACAAGAGCTTGCAAACATGATTCTGCCTGAAGATGAAAATTTTCTGTTGCTGTTTCGCCGAGAAACTCCATTGGATAACAGCGTGGAGTTCATGCGGATTTGGAGGAAATTTGATGAGGATAGCAGTGGATTTATCTCAGCAGTTGAACTCAGGAATTTCTTGCAAGATCTGTTCTTACAGCACAAGAAACATATTACAGGTGACAAGCTGGATGAATATACAGACACCATGATGAAACTGTTCAACAGAAATAAAGATGGACGGCTAGACCTGAATGACTTGGCAAAGATCCTGGCTCTGCAAGAAAATTTCCTTCTTCAATTCAAAATGGATGCAAGTAGCCAAGAGGAAAGAAAGAGCGACTTTGAAACTATCTTTGCGCACTATGATGTTAGTAAAACAGGAGCATTAGAGGGGTCCAGAAGTGAACGGATTTGTCAAAGATATGATGGAACTTTGTGAAGCAAGCATCAATTGGTGTTGAACTCGATAAAATTCCGTCAAATCCCATTAAACCCTTTGTAATTTTCAACAAAGGATGGGGAAAAATCCAAAAATTCCTAAACTGGCCCCTTGGGGCCTGTGCTCTAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACAGCGCCTTCCTGAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839768
dbEST ID: 79657470
Trimmed Sequence: GGGGTTTGCTTTTAGACCAAGGCACAGTGCCAGTTCAGACTTCTGGATTTTCCCATCCTTGTTGACATCACAATGGTTTAATAGGATCTGACGGAATTTATCGAGGTCCACACCACTGATGCTTGGCTTCACAAGTTCCATCATATCTTTGACAAATCCGTCCACTTCTGGACCCTCTAATGCTCCTGTTTTACTAACATCATAGTGCGCAAAGATAGTTTCAAAGTCGCTCTTTCTTTCCTCTTGGCTACTTGCATCCATTTTGAATTGAAGAAGGAAATTTTCTTGCAGAGCCAGGATCTTTGCCAAGTCATTCAGGTCTAGCCGTCCATCTTTATTTCTGTTGAACAGTTTCATCATGGTGTCTGTATATTCATCCAGCTTGTCACCTGTAATATGTTTCTTGTGCTGTAAGAACAGATCTTGCAAGAAATTCCTGAGTTCAACTGCTGAGATAAATCCACTGCTATCCTCATCAAATTTCCTCCAAATCCGCATGAACTCCACGCTGTTATCCAATGGAGTTTCTCGGCGAAACAGCAACAGAAAATTTTCATCTTCAGGCAGAATCATGTTTGCAAGCTCTTGTATTTGTAGACGTCCATCAGCGGTAATGTCATACGCAGACATAAATCGATCTTTCACCCCCTGAACCCTATCAGCTGTTTATTGCATTTGTGCCCCGTTTTCTTAAGCAAATGGCAAAGAAATTCATCCAACTTCCTTTGCCCTCAATGGTACCCCTTGTTCATCAGCCATTCAAAGGCGCTTCC
Full Trace Sequence: GGACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGGTTTGCTTTTAGACCAAGGCACAGTGCCAGTTCAGACTTCTGGATTTTCCCATCCTTGTTGACATCACAATGGTTTAATAGGATCTGACGGAATTTATCGAGGTCCACACCACTGATGCTTGGCTTCACAAGTTCCATCATATCTTTGACAAATCCGTCCACTTCTGGACCCTCTAATGCTCCTGTTTTACTAACATCATAGTGCGCAAAGATAGTTTCAAAGTCGCTCTTTCTTTCCTCTTGGCTACTTGCATCCATTTTGAATTGAAGAAGGAAATTTTCTTGCAGAGCCAGGATCTTTGCCAAGTCATTCAGGTCTAGCCGTCCATCTTTATTTCTGTTGAACAGTTTCATCATGGTGTCTGTATATTCATCCAGCTTGTCACCTGTAATATGTTTCTTGTGCTGTAAGAACAGATCTTGCAAGAAATTCCTGAGTTCAACTGCTGAGATAAATCCACTGCTATCCTCATCAAATTTCCTCCAAATCCGCATGAACTCCACGCTGTTATCCAATGGAGTTTCTCGGCGAAACAGCAACAGAAAATTTTCATCTTCAGGCAGAATCATGTTTGCAAGCTCTTGTATTTGTAGACGTCCATCAGCGGTAATGTCATACGCAGACATAAATCGATCTTTCACCCCCTGAACCCTATCAGCTGTTTATTGCATTTGTGCCCCGTTTTCTTAAGCAAATGGCAAAGAAATTCATCCAACTTCCTTTGCCCTCAATGGTACCCCTTGTTCATCAGCCATTCAAAGGCGCTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGGTTTGCTTTTAGACCA