ORFeome > sgpl1 ORF1 – XORFeome v1.0

sgpl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sgpl1
Gene ID: 997690
Gene Page ID: 997684
ORF Xenbase ID: 17296209

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130099
Original XGC clone length: 1362

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ837637
dbEST ID: 79655339
Trimmed Sequence: ATGGCGGTGCAGGAGACTTTGGAAGTCTATAAGGAAATCGGTCTGACTTACGCATTTCAGTTAAGAAACTTCACTTTGACTAGTGTGTTCCAGTTAAGAAACCTTATAAATGAGAGCTGTAAAGACACTGAACCATGGTATCTGATTGTTTTAACCTCTGGATGTACTCTGATGTTGATATCCCTTTATGGAATCATTTTCCAGTCTGAAAGTCTCCTTTCCAGATGTAAAAAACTGTTTTTCAGAATAGTTCGAAGGTTGCCATATGTTGGTGCACAGATACAATGTAAGCTGAATAAAGCTTTGAATGAAATGTCGGAGAGAATGGTTCTAAAAAATGGCTTCAACTATATTCATGCGTTGCCTCAAACTGGGCTGAAGCAGGAACAAGTAATGGAGAAGCTGAAGAAGGAATACTCATCAATTGGAGATGTTTCTTGGGAAACTGGAAAGGTATCTGGAACAGTTTATAGTGGGGACGAAAGGCTGACACAGCTTCTTGTAAAGGTTTATGGAGAGTTTGCATGGACCAATCCTCCGCATTCTGATATTTTCCCTGGTCTACGGTTGATGGAAGCAGAAAATGTTGAGGATGACGTGAATTTCTCTTCAATGGCAGGCCCGCTCCCCTGTCAAACAGATAGCATCATTTGGAACGGGAAAGAAGTCTCATGGCTTGGCGGGGGCTGCAAAAGATTTTGGGTTGACACTAGCGAAAATA
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGCAGGAGACTTTGGAAGTCTATAAGGAAATCGGTCTGACTTACGCATTTCAGTTAAGAAACTTCACTTTGACTAGTGTGTTCCAGTTAAGAAACCTTATAAATGAGAGCTGTAAAGACACTGAACCATGGTATCTGATTGTTTTAACCTCTGGATGTACTCTGATGTTGATATCCCTTTATGGAATCATTTTCCAGTCTGAAAGTCTCCTTTCCAGATGTAAAAAACTGTTTTTCAGAATAGTTCGAAGGTTGCCATATGTTGGTGCACAGATACAATGTAAGCTGAATAAAGCTTTGAATGAAATGTCGGAGAGAATGGTTCTAAAAAATGGCTTCAACTATATTCATGCGTTGCCTCAAACTGGGCTGAAGCAGGAACAAGTAATGGAGAAGCTGAAGAAGGAATACTCATCAATTGGAGATGTTTCTTGGGAAACTGGAAAGGTATCTGGAACAGTTTATAGTGGGGACGAAAGGCTGACACAGCTTCTTGTAAAGGTTTATGGAGAGTTTGCATGGACCAATCCTCCGCATTCTGATATTTTCCCTGGTCTACGGTTGATGGAAGCAGAAAATGTTGAGGATGACGTGAATTTCTCTTCAATGGCAGGCCCGCTCCCCTGTCAAACAGATAGCATCATTTGGAACGGGAAAGAAGTCTCATGGCTTGGCGGGGGCTGCAAAAGATTTTGGGTTGACACTAGCGAAAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGCAGGAGACTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837636
dbEST ID: 79655338
Trimmed Sequence: GGCTTCCCAAAAATAAAAATGTCTTTCATTTTCCGCAACTCTGTTTCGATGAACCGTGCTGCTTTGATGATTTTTTTTGGTAGCCTCTATATAGCCATCTTCCCCTATGTGCATCATTGTGGCCCAGCATGCAGCGATTATTCCTCCAGGACGGGAACCAGCTATAGCAGGTGATGCATAGATGCCACCTTGCCAATCCGGCGCAACAAAGAACTGATAATGCCGATATTTTTTGTCACTATACATGATCACCGAAGAACCTTTTGGTGCATACCCATACTTGTGTGTGTCCGCAGATATACTAGTGACTCCTTTTACTCTAAAGTCAAAAGGCTTTAATGGGAAACCAGCTTTCTTCATAAATACAATGAGAAAACCACCCAGACATGCATCCACGTGAAATGGAAGTTGGTATTTCAAAGCAAGCTTAGCAACTTCTTCTATTGGGTCAATGATGCCATGAGGAAATTGAGGAGCTGAACATACAAGCATGGCTGTATTTTTAAAAATTGCTCTTTTCATTGCCTTAACATCCACTTGCATTGTAGCTTTGTTTACTGGAATATGCACAATCTTCATCCCGAAATAATGAGCGGCCTTATCAAAAGCTGCATGGGCACTAACAGGAGCCACATTTTCTGGGGTGCTTAATTTCCCTTTTCATAAACCAAAATCTCCGTTAAACCCTTGCAAGCCAATAAAAAAGGCCTTTTCTGTTCCACCCTA
Full Trace Sequence: CGGGAAAATGTCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCTTCCCAAAAATAAAAATGTCTTTCATTTTCCGCAACTCTGTTTCGATGAACCGTGCTGCTTTGATGATTTTTTTTGGTAGCCTCTATATAGCCATCTTCCCCTATGTGCATCATTGTGGCCCAGCATGCAGCGATTATTCCTCCAGGACGGGAACCAGCTATAGCAGGTGATGCATAGATGCCACCTTGCCAATCCGGCGCAACAAAGAACTGATAATGCCGATATTTTTTGTCACTATACATGATCACCGAAGAACCTTTTGGTGCATACCCATACTTGTGTGTGTCCGCAGATATACTAGTGACTCCTTTTACTCTAAAGTCAAAAGGCTTTAATGGGAAACCAGCTTTCTTCATAAATACAATGAGAAAACCACCCAGACATGCATCCACGTGAAATGGAAGTTGGTATTTCAAAGCAAGCTTAGCAACTTCTTCTATTGGGTCAATGATGCCATGAGGAAATTGAGGAGCTGAACATACAAGCATGGCTGTATTTTTAAAAATTGCTCTTTTCATTGCCTTAACATCCACTTGCATTGTAGCTTTGTTTACTGGAATATGCACAATCTTCATCCCGAAATAATGAGCGGCCTTATCAAAAGCTGCATGGGCACTAACAGGAGCCACATTTTCTGGGGTGCTTAATTTCCCTTTTCATAAACCAAAATCTCCGTTAAACCCTTGCAAGCCAATAAAAAAGGCCTTTTCTGTTCCACCCTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCTTCCCAAAAATAAAAATGTCT