ORFeome > slc10a7 ORF1 – XORFeome v1.0

slc10a7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slc10a7
Gene ID: 865863
Gene Page ID: 489388
ORF Xenbase ID: 17296551

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056022
Original XGC clone length: 1032

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ824621
dbEST ID: 79642323
Trimmed Sequence: ATGGGCCTGCTGGAGAGACTGAGGAAAGAATGGTTTATTGTCGGCATTATCCTGGTTATCGCAGCTGCTAAACTGGAACCTACCGTGGGAGTGAAAGGGGGGCCATTGAAGCCAGAAATTACCATCACGTATATTGCAGTGTCTGCTATATTCTTTAACAGTGGACTCTCCTTAAAAACAGAGGAACTGACAAATGCATTGATGCATGTAAAGCTTCATCTTTTTGTCCAGCTTTTTACACTCGTCTTCTTCCCCACAGCAATATGGCTTTTCCTTCAAGTTCTGTCTCTTACACCCATAAATGAATGGCTGTTGAAGGGTTTGCAGACAGTAAGCTGTATGCCTCCTCCTGTTTCATCAGCTGTGATCTTGACCAAAGCTGTCGGTGGTAATGAGGCTGCTGCCATTTTCAACTCTGCATTTGGAAGCTTCTTGGGCATTGTTGTAACACCACTGCTGCTGCTCCTCTTTCTGGGATCTTCCTCTTCAGTACCTTTTACCTCCATATTCTCTCAGCTGTTTATGACTGTCGTTGTTCCACTTATCATTGGTCAGATTGTACGACGCTACATCAAGGACTGGCTGGAAAGGAAGAAGCCACCATTTGGGGCCATCAGCAGCTGTGTCCTTCTAATGANATCTACACAACATTCTGTGACACATTCTCCAACCAAACATTGACTAGACACTTTCAGTTGGGTTGGTATGTATTTATCNATTTTTTTATCCGGTGGGCATCATGCTTTTAACAATCCTCCTTTCTACAACCAAAAAAAATTGGTTTTTATCCCCCCCCCAACCCGGGGGGGCAAAAAAATTTTTGCCTCACC
Full Trace Sequence: TAATGATTTTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCCTGCTGGAGAGACTGAGGAAAGAATGGTTTATTGTCGGCATTATCCTGGTTATCGCAGCTGCTAAACTGGAACCTACCGTGGGAGTGAAAGGGGGGCCATTGAAGCCAGAAATTACCATCACGTATATTGCAGTGTCTGCTATATTCTTTAACAGTGGACTCTCCTTAAAAACAGAGGAACTGACAAATGCATTGATGCATGTAAAGCTTCATCTTTTTGTCCAGCTTTTTACACTCGTCTTCTTCCCCACAGCAATATGGCTTTTCCTTCAAGTTCTGTCTCTTACACCCATAAATGAATGGCTGTTGAAGGGTTTGCAGACAGTAAGCTGTATGCCTCCTCCTGTTTCATCAGCTGTGATCTTGACCAAAGCTGTCGGTGGTAATGAGGCTGCTGCCATTTTCAACTCTGCATTTGGAAGCTTCTTGGGCATTGTTGTAACACCACTGCTGCTGCTCCTCTTTCTGGGATCTTCCTCTTCAGTACCTTTTACCTCCATATTCTCTCAGCTGTTTATGACTGTCGTTGTTCCACTTATCATTGGTCAGATTGTACGACGCTACATCAAGGACTGGCTGGAAAGGAAGAAGCCACCATTTGGGGCCATCAGCAGCTGTGTCCTTCTAATGANATCTACACAACATTCTGTGACACATTCTCCAACCAAACATTGACTAGACACTTTCAGTTGGGTTGGTATGTATTTATCNATTTTTTTATCCGGTGGGCATCATGCTTTTAACAATCCTCCTTTCTACAACCAAAAAAAATTGGTTTTTATCCCCCCCCCAACCCGGGGGGGCAAAAAAATTTTTGCCTCACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCCTGCTGGAGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829971
dbEST ID: 79647673
Trimmed Sequence: TAATGGAATCTTCGGCTGCCTTGTTAATTTCAGGGCCTTCTGCCTGGAGAGCATCCATGACTTTATTGTTGGTACTAATACACTTCCGAGAAGGATTTGAGCCGGGTGGTAGATTAGCAGCGGAACGGATATTAATGACAGGTGTTCATATCCTACAAACACGATCTTCAGCATAGGGATTCCTAGGGTGAGGGACTTGTGTGTTGAGCAAAATACTATTGCCACCGTGTCGGCTGGAGTAAAACCACTGTTTTTGCTTGTAGAAAAGAGGAATGTTAAAAGCATGAATGCCAACTGGATAAAAAATATGATAAATACAATAACAACCAAACTGAAAGTGTCTAGGTCAATGTTTGGGTTGGAGAATGTGTCACAGAATGTTGTGTAGATAATCATTAGAAGGACACAGCTGCTGATGGCCCCAAATGGTGGCTTCTTCCTTTCCAGCCAGTCCTTGATGTAGCGTCGTACAATCTGACCAATGATAAGTGGAACAACGACAGTCATAAACAGCTGAGAGAATATGGAGGTAAAAGGTACTGAAGAGGAAGATCCCAGAAAGAGGAGCAGCAGCAGTGGTGTTTACACAATGCCCAAGAAGCTTCCAAATGCAGAGTTGAAAATGGCAGCAGCCTCATTACCACCGACAGCTTTGGTCAAGATCACAGCTGATGAAAACAGGAGGAGGCCATAACAGCTTAACTGTCTGCAAACCCCTCAACCACCCTTTCCCTTTTATGGGGTGTTAAAAAAAACAAAAA
Full Trace Sequence: CAGCGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAATGGAATCTTCGGCTGCCTTGTTAATTTCAGGGCCTTCTGCCTGGAGAGCATCCATGACTTTATTGTTGGTACTAATACACTTCCGAGAAGGATTTGAGCCGGGTGGTAGATTAGCAGCGGAACGGATATTAATGACAGGTGTTCATATCCTACAAACACGATCTTCAGCATAGGGATTCCTAGGGTGAGGGACTTGTGTGTTGAGCAAAATACTATTGCCACCGTGTCGGCTGGAGTAAAACCACTGTTTTTGCTTGTAGAAAAGAGGAATGTTAAAAGCATGAATGCCAACTGGATAAAAAATATGATAAATACAATAACAACCAAACTGAAAGTGTCTAGGTCAATGTTTGGGTTGGAGAATGTGTCACAGAATGTTGTGTAGATAATCATTAGAAGGACACAGCTGCTGATGGCCCCAAATGGTGGCTTCTTCCTTTCCAGCCAGTCCTTGATGTAGCGTCGTACAATCTGACCAATGATAAGTGGAACAACGACAGTCATAAACAGCTGAGAGAATATGGAGGTAAAAGGTACTGAAGAGGAAGATCCCAGAAAGAGGAGCAGCAGCAGTGGTGTTTACACAATGCCCAAGAAGCTTCCAAATGCAGAGTTGAAAATGGCAGCAGCCTCATTACCACCGACAGCTTTGGTCAAGATCACAGCTGATGAAAACAGGAGGAGGCCATAACAGCTTAACTGTCTGCAAACCCCTCAACCACCCTTTCCCTTTTATGGGGTGTTAAAAAAAACAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATGGAATCTTCGGCTGCCT