ORFeome > smarce1 ORF1 – XORFeome v1.0

smarce1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: smarce1
Gene ID: 482515
Gene Page ID: 482510
ORF Xenbase ID: 17297577

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC041216
Original XGC clone length: 1209

Human orthology & disease relationships

NCBI Entrez ID: 6605
Ensembl gene IDs: ENSG00000073584
Directly associated (OMIM) disease MIM numbers: 607174
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,151623,182290,275355,300055,300279,300458,300496,312750,600652,603278,603622,605249,607841,609322

Library Location

Plate ID: GDExl11007
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ823596
dbEST ID: 79641298
Trimmed Sequence: ATGCCCAGCACACCAGGGTTTGTGGGATACAATCCATACAGCCATCTTGCCTACAACAACTACAGGCTGGGAGGGAACGCAGGCAGCAACAGCAGGGCCACGGCTTCATCAGGCATTACAATACCAAAGCCACCTAAGCCTCCAGATAAGCCATTGATGCCATATATGCGATACAGCAGGAAGGTCTGGGACCAAGTGAAGGCTTCCAACCCTGACCTTAAGTTGTGGGAGATTGGCAAGATCATTGGTGGGATGTGGCGAGACCTAACCGATGAGGAGAAGCAAGAGTACTTGAACGAATATGAAGCTGAAAAGATTGAATACAATGAATCAATGAAGACCTACCACAACTCTCCTGCTTATCTCGCTTACATCAGTGCCAAAAGCCGAGCAGAAGCCGCCCTCGAGGAGGAAAGTCGCCAGAGGCAGTCGCGAATGGACAAGGGGGAGCCATACATGAGCATCCAGCCTGCTGAAGATCCTGATGATTATGACGATGGCTTCTCCATGAAGCACACAGCAGCTGCCCGTTTCCAGAGGAATCACAGACTGATCAGTGAAATTCTGAGTGAAAGTGTGGTGCCTGATGTCCGTTCAGTGGTCACGACTGCTCGAATGCAGGTTCTTAAAAGACAAGTTCAGTCACTCATGGTGCACCAGCGCAAGTTGGAGGCAGAATTGTTACAGATAGAGGATCGCCACAAAGATAAGAAGGAGAAAATTCTTGGAAAGCACAGAGTCTTTTACAATGAGTTGGAGCCGGCGTGTTATTTTAAAGGGGGAGGGGGGGGATAAGGGAAAAAAAATGGCGC
Full Trace Sequence: CAATACTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCAGCACACCAGGGTTTGTGGGATACAATCCATACAGCCATCTTGCCTACAACAACTACAGGCTGGGAGGGAACGCAGGCAGCAACAGCAGGGCCACGGCTTCATCAGGCATTACAATACCAAAGCCACCTAAGCCTCCAGATAAGCCATTGATGCCATATATGCGATACAGCAGGAAGGTCTGGGACCAAGTGAAGGCTTCCAACCCTGACCTTAAGTTGTGGGAGATTGGCAAGATCATTGGTGGGATGTGGCGAGACCTAACCGATGAGGAGAAGCAAGAGTACTTGAACGAATATGAAGCTGAAAAGATTGAATACAATGAATCAATGAAGACCTACCACAACTCTCCTGCTTATCTCGCTTACATCAGTGCCAAAAGCCGAGCAGAAGCCGCCCTCGAGGAGGAAAGTCGCCAGAGGCAGTCGCGAATGGACAAGGGGGAGCCATACATGAGCATCCAGCCTGCTGAAGATCCTGATGATTATGACGATGGCTTCTCCATGAAGCACACAGCAGCTGCCCGTTTCCAGAGGAATCACAGACTGATCAGTGAAATTCTGAGTGAAAGTGTGGTGCCTGATGTCCGTTCAGTGGTCACGACTGCTCGAATGCAGGTTCTTAAAAGACAAGTTCAGTCACTCATGGTGCACCAGCGCAAGTTGGAGGCAGAATTGTTACAGATAGAGGATCGCCACAAAGATAAGAAGGAGAAAATTCTTGGAAAGCACAGAGTCTTTTACAATGAGTTGGAGCCGGCGTGTTATTTTAAAGGGGGAGGGGGGGGATAAGGGAAAAAAAATGGCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCAGCACACCAGGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ828895
dbEST ID: 79646597
Trimmed Sequence: GTTCTTGTGATCAGGCTCTTCCGCTACTGAGTCTGTGGTGGGTTCTTCCACGGTGCCGCTGTTGCTCTCAGAGCCAGTGTTGCTGTCGGTGGTCCCTTCATCTAGGGTGCTGTCCACTGCCTCCTGCCCATTCTCCTTGTCATCTGGGGTTGATGTTCCCTCCTCGCCATTCTGTTGGCTCTCACTGGTTTCATCTGGTGGGGGCAGGGAAGGGGTGTCTTCCGTCTCCATTGGGGCCTCTTCCTCTTCAGTCTTTTCTTCTGGTTTTGCCGCTTCTTGCTCTTCCTCTGCAGCAGCGGTGGCGGCAGCTGCATTTTGATTGCGCTCTGCTTGTTCCGCAGCCTCCTTTTCCCTCTCCTCCTGCCGCTTCCTTGCCTGCTCTTCTGCCTGGGCGATCTCTGCTGCAATCTTATCCATATCCACCTCCACCTTTAAATTACACAGCCGCTTCAACTCATTGTTAAAGGACTCTGTGCTTTCCAAGAATTTTCTCTTCTTATCTTGGTGGCGATCCTCTATCTGTAACAATTCTGCCTCCAACTTGCGCTGGTGCACCATGAGTGACTGAACTTGTCTTTTAAGAACCTGCATTCGAGCAGTCGTGACCACTGAACGGACATCAAGCACCACACTTTCACTCAGAATTTCACTGATCAATCTGTGATTCCTCTGGAAACGGGGCAGCTGCTGTGTGCTTCATGGAAAA
Full Trace Sequence: TGCAGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCTTGTGATCAGGCTCTTCCGCTACTGAGTCTGTGGTGGGTTCTTCCACGGTGCCGCTGTTGCTCTCAGAGCCAGTGTTGCTGTCGGTGGTCCCTTCATCTAGGGTGCTGTCCACTGCCTCCTGCCCATTCTCCTTGTCATCTGGGGTTGATGTTCCCTCCTCGCCATTCTGTTGGCTCTCACTGGTTTCATCTGGTGGGGGCAGGGAAGGGGTGTCTTCCGTCTCCATTGGGGCCTCTTCCTCTTCAGTCTTTTCTTCTGGTTTTGCCGCTTCTTGCTCTTCCTCTGCAGCAGCGGTGGCGGCAGCTGCATTTTGATTGCGCTCTGCTTGTTCCGCAGCCTCCTTTTCCCTCTCCTCCTGCCGCTTCCTTGCCTGCTCTTCTGCCTGGGCGATCTCTGCTGCAATCTTATCCATATCCACCTCCACCTTTAAATTACACAGCCGCTTCAACTCATTGTTAAAGGACTCTGTGCTTTCCAAGAATTTTCTCTTCTTATCTTGGTGGCGATCCTCTATCTGTAACAATTCTGCCTCCAACTTGCGCTGGTGCACCATGAGTGACTGAACTTGTCTTTTAAGAACCTGCATTCGAGCAGTCGTGACCACTGAACGGACATCAAGCACCACACTTTCACTCAGAATTTCACTGATCAATCTGTGATTCCTCTGGAAACGGGGCAGCTGCTGTGTGCTTCATGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCTTGTGATCAGGCTCTT