ORFeome > snrpb ORF1 – XORFeome v1.0

snrpb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: snrpb
Gene ID: 5877790
Gene Page ID: 5877282
ORF Xenbase ID: 17297931

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108497
Original XGC clone length: 705

Human orthology & disease relationships

NCBI Entrez ID: 6628
Ensembl gene IDs: ENSG00000125835
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,253300,253400,253550,256710,300590,303600,600059,600334,601414,603689,604145,608807,608808,609065,609227

Library Location

Plate ID: GDExl11087
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ837922
dbEST ID: 79655624
Trimmed Sequence: ATGACGGTGGGAAAAAGCAGCAAGATGCTGCAGCACATTGACTTCAGAATGCGCTGTACCCTTCAAGATGGAAGGATCTTTATTGGAACATTCAAGGCATTTGACAAACACATGAATCTCATCTTATGTGACTGTGATGAATTTAGAAAGATTAAGCCAAAGAACTCCAAACAGCCAGAACGTGAAGAAAAGAGGGTACTTGGTCTAGTGTTGCTTCGAGGGGAGAACTTGGTGTCCATGACTGTTGAAGGCCCACCTCCCAAAGATACTGGCATTGCCAGGGTTCCATTGGCAGGAGCTGCTGGAGGACCTGGAGTAGGCAGGGCAGCTGGCAGAGGTGTACCTGCTGGAGCACCTATGCCTCAGGCTCCTGCTGGACTGGCAGGACCAGTACGTGGTGTGGGAGGACCATCACAGCAGGTTATGACGCCTCAGGGTCGTGGTAATGTGGTAGCAGCTGCCACAGCTAGCATTGCTGGAGCCCCAACACAGTATGCAGCAGGTCGTGGAGGACTACTTCCACCAATGGGCAGAGGAGCACCCCCTCCCCGCATGATGGGGCCACCCCCTGGCATGAGGCCGGCCATGGGTCCACCAATGGGAATGCCTCCCGGCAGAGGAGGACCTATGGGAATGCCACCTCCAGGCATGAGAAGACCTCACCCTGGAACCTCCCCAACCTGGATGCAACCCCCTCGGGCCATTGCCAACTTTCTTGGTACAAGTTGGCGTTTTTAAGAAAGAAATTGCTTAAACATTTTTGTGGAAAGAAAAAGGGTACCTTCCAATTAAAAAATAAAATAATTTATTTTTTCC
Full Trace Sequence: TCGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACGGTGGGAAAAAGCAGCAAGATGCTGCAGCACATTGACTTCAGAATGCGCTGTACCCTTCAAGATGGAAGGATCTTTATTGGAACATTCAAGGCATTTGACAAACACATGAATCTCATCTTATGTGACTGTGATGAATTTAGAAAGATTAAGCCAAAGAACTCCAAACAGCCAGAACGTGAAGAAAAGAGGGTACTTGGTCTAGTGTTGCTTCGAGGGGAGAACTTGGTGTCCATGACTGTTGAAGGCCCACCTCCCAAAGATACTGGCATTGCCAGGGTTCCATTGGCAGGAGCTGCTGGAGGACCTGGAGTAGGCAGGGCAGCTGGCAGAGGTGTACCTGCTGGAGCACCTATGCCTCAGGCTCCTGCTGGACTGGCAGGACCAGTACGTGGTGTGGGAGGACCATCACAGCAGGTTATGACGCCTCAGGGTCGTGGTAATGTGGTAGCAGCTGCCACAGCTAGCATTGCTGGAGCCCCAACACAGTATGCAGCAGGTCGTGGAGGACTACTTCCACCAATGGGCAGAGGAGCACCCCCTCCCCGCATGATGGGGCCACCCCCTGGCATGAGGCCGGCCATGGGTCCACCAATGGGAATGCCTCCCGGCAGAGGAGGACCTATGGGAATGCCACCTCCAGGCATGAGAAGACCTCACCCTGGAACCTCCCCAACCTGGATGCAACCCCCTCGGGCCATTGCCAACTTTCTTGGTACAAGTTGGCGTTTTTAAGAAAGAAATTGCTTAAACATTTTTGTGGAAAGAAAAAGGGTACCTTCCAATTAAAAAATAAAATAATTTATTTTTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGGTGGGAAAAAGCAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837921
dbEST ID: 79655623
Trimmed Sequence: TGGCCGAGCGGGTCGCATGCCAGGTGGGGGAGGTCCAGGTGGAGGTGGTCTCATGCCTGGAGGTGGCATTCCCATAGGTCCTCCTCTGCCTGGAGGCATTCCCATTGGTGGACCCATTGGCGGCCTCATGCCAGGGGGTGGCCCCATCATGCCTGGAGGGGGTGCTCCTCTGCCCATTGGTGGAAGTAGTCCTCCACGACCTGCTGCATACTGTGTTGGGGCTCCAGCAATGCTAGCTGTGGCAGCTGCTACCACATTACCACGACCCTGAGGCGTCATAACCTGCTGTGATGGTCCTCCCACACCACGTACTGATCCTGCCGCTCCTGCAGGAGCCTGAGGCATAGGTGCTCCGGCAGGTACACCTCTGCCAGCTGCCCTGCCTACTCCAGGTCGGCGAGCAGCTCCTGCCAATGGAACCCTGGCAGTGCCAGGGTCTTTGGGAGGGGGGGGGTCCGACAGCAGGAACGGGAAGTTCTCCCCTCGAGGCACACTCCACAACGTACCGTGTATGCTTCCCGTCCTCGGGGTTGGGGGGTCGGGGGCTTATTCGTACTTATTCTCCCAGTCACAAGAGAAAAGATTCAAGGGTTTTTCGGGTGCCGTGAGTGGGCCCGGGGGGGACTCCTTCCTCCTGGGGGGGAGGGGGGGGGGGGAAGGGCAAGGGGGGGGGGGGGGGGGGAGGGTTTTTGCCGGGGNCCTTTAATCCAATCGTTTGGGGGACAAATTTGTGGCAATAAAAAAAGGGAGAGA
Full Trace Sequence: GGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGCCGAGCGGGTCGCATGCCAGGTGGGGGAGGTCCAGGTGGAGGTGGTCTCATGCCTGGAGGTGGCATTCCCATAGGTCCTCCTCTGCCTGGAGGCATTCCCATTGGTGGACCCATTGGCGGCCTCATGCCAGGGGGTGGCCCCATCATGCCTGGAGGGGGTGCTCCTCTGCCCATTGGTGGAAGTAGTCCTCCACGACCTGCTGCATACTGTGTTGGGGCTCCAGCAATGCTAGCTGTGGCAGCTGCTACCACATTACCACGACCCTGAGGCGTCATAACCTGCTGTGATGGTCCTCCCACACCACGTACTGATCCTGCCGCTCCTGCAGGAGCCTGAGGCATAGGTGCTCCGGCAGGTACACCTCTGCCAGCTGCCCTGCCTACTCCAGGTCGGCGAGCAGCTCCTGCCAATGGAACCCTGGCAGTGCCAGGGTCTTTGGGAGGGGGGGGGTCCGACAGCAGGAACGGGAAGTTCTCCCCTCGAGGCACACTCCACAACGTACCGTGTATGCTTCCCGTCCTCGGGGTTGGGGGGTCGGGGGCTTATTCGTACTTATTCTCCCAGTCACAAGAGAAAAGATTCAAGGGTTTTTCGGGTGCCGTGAGTGGGCCCGGGGGGGACTCCTTCCTCCTGGGGGGGAGGGGGGGGGGGGAAGGGCAAGGGGGGGGGGGGGGGGGGAGGGTTTTTGCCGGGGNCCTTTAATCCAATCGTTTGGGGGACAAATTTGTGGCAATAAAAAAAGGGAGAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGCCGAGCGGGTCGCAT