ORFeome > suclg2 ORF1 – XORFeome v1.0

suclg2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: suclg2
Gene ID: 956246
Gene Page ID: 956241
ORF Xenbase ID: 17299419

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108802
Original XGC clone length: 1296

Human orthology & disease relationships

NCBI Entrez ID: 8801
Ensembl gene IDs: ENSG00000172340
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 115310,150800,171300,231670,248600,251000,252011,256000,312170,605373,605839,606812

Library Location

Plate ID: GDExl11085
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ837707
dbEST ID: 79655409
Trimmed Sequence: ATGGCCGCCTCCATAGTTGCACGGGCAGGGAATCTGCTGGGGAATTTCACAGCGAAGGGCGCTTTGCTCCGTACAACTCAGGGTGTTCACGTGAGCTCCAGAAGATGGCTGAACCTACAGGAATATCAGAGCAAAAAGCTGATGGCAGACTATGGTGTCACTGTTCAACGGTTCATTGTTGCCGACAACGCCAGTGAAGCTCTGGAAGCAGCAAAAAAACTAAAAGCCCGGGAAATTGTTTTAAAGGCTCAAATCTTGGCTGGAGGAAGAGGCAAAGGAACGTTTGACAGCGGGCTGAAAGGCGGCGTCCATTTAACTAAAGACCCCAGCAAGGTAGAAGAACTGACCAAACAAATGATTGGGTTTAATCTGACCACAAAACAGACGGCAGCTGGAGGTGTTAAAGTCCAAAAGGTAATGGTTGCTGAGGCTCTGGACATTACAAGAGAAACCTACTTGGCTATATTAATGGACCGAGCTTGTAATGGACCTGTTTTAGTTGGAAGTCCTCAAGGAGGAATGGACATTGAAAAAATGGCGGAGAAAACACCTGAACTTATTTTTAAGGAGGAAATCGACATTTTCCAAAGTGTAAAAGACTGCCCAACGTTGCGGATGGCCGAAGATTTAAGGATTTAAAGGACCCCTTCCACACCAGGCTTCCGAGCAAATTAAAAAAGCTTGTCGGATCCCCTTCCTGAAAGGTGGAGGCCCACCCCCACCCAAAAATCAGCCCAATTC
Full Trace Sequence: CCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGCCTCCATAGTTGCACGGGCAGGGAATCTGCTGGGGAATTTCACAGCGAAGGGCGCTTTGCTCCGTACAACTCAGGGTGTTCACGTGAGCTCCAGAAGATGGCTGAACCTACAGGAATATCAGAGCAAAAAGCTGATGGCAGACTATGGTGTCACTGTTCAACGGTTCATTGTTGCCGACAACGCCAGTGAAGCTCTGGAAGCAGCAAAAAAACTAAAAGCCCGGGAAATTGTTTTAAAGGCTCAAATCTTGGCTGGAGGAAGAGGCAAAGGAACGTTTGACAGCGGGCTGAAAGGCGGCGTCCATTTAACTAAAGACCCCAGCAAGGTAGAAGAACTGACCAAACAAATGATTGGGTTTAATCTGACCACAAAACAGACGGCAGCTGGAGGTGTTAAAGTCCAAAAGGTAATGGTTGCTGAGGCTCTGGACATTACAAGAGAAACCTACTTGGCTATATTAATGGACCGAGCTTGTAATGGACCTGTTTTAGTTGGAAGTCCTCAAGGAGGAATGGACATTGAAAAAATGGCGGAGAAAACACCTGAACTTATTTTTAAGGAGGAAATCGACATTTTCCAAAGTGTAAAAGACTGCCCAACGTTGCGGATGGCCGAAGATTTAAGGATTTAAAGGACCCCTTCCACACCAGGCTTCCGAGCAAATTAAAAAAGCTTGTCGGATCCCCTTCCTGAAAGGTGGAGGCCCACCCCCACCCAAAAATCAGCCCAATTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGCCTCCATAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837706
dbEST ID: 79655408
Trimmed Sequence: ATTCTTCGCTATGCTCGCCACCGCTTTCTTTGCTGCGTCATCCAGGTCGTTGGCAGAGGTAATGGGGAGCCCACTTTCTGCCAGAATTCGCTTGGCTTCGTGGACATTCGTTCCTTCTAGTCTGACCACCAAGGGAACCTTCAGTTCAAGCTCTCTGCAGGCCTTCGTTATCCCATTAGCTATAATTGCGCAGTTAACAATCCCTCCGAATATGTTGACAAGGATCGCTTCAACCCTGGGATCTGCAGTGAGCAGCTTGAAGGCTTGGTATACTTGCGACTCTTTCACACCACCGCCAAGATCAAGGAAGTTGGCTGGTTTTCCTCCATGCAAGTCAATGATATCACATGTTGCCATTGCGAGGCCCGCACCATTTACAAAGCAAGCTATGTTTCCATCCAAGCCGATATACTTCAAATCGTAACTGTTGGCTTCGTTCTCTATCGGGTCCATCTCCAAAGTGTTGTCCATGGCAAAGATCTCTTTTTGTCGGAATTCTGCATTGTCATCAAAGTTAATCTTGGCATCAAAGCACACAACTTGTCCTTCTGGAGTTTCTCCGAATGGGTTGATCTCGACTTGCGTGGCGTCCACTTTCAGGAAAAGAACGTACAGCCTCTTAATTTGCTCGGCAGCCTGCTGGTGAAGGGGTCCTTTAAATCCTAAATTGTCGGCGATCGGCAACGCCTGGCGGTCTTTTACACCTTCCAAAAATGTCAATTTCCTCCTTAAAAATAATTTCAGGTGTTTCGTCGCCACCTCGCCAATGTCCAATTGGCCCTTAAGACTTCGACTAAAAAAGGACCATAAGAACCTCGTTCCATTAAAAACCCAAATAAGTTTTTTCTGGAGTGTCTCGGAGCGTGGCGAGACCTTACTTTTGAAACTAGAGGGGGTCGACCTGCCGCCTGGTTTGGGTGGTGAAAGGAGGGGCAAACAATTAGTTTGGGTGGTTGGGGTGGAGGTTGCCTCGGTTTTTTAGTAGAAATAGAAACCCGCGCCTACGGCCCGCCGCTTCCAAAGTCTCGCGTTGCCCTTTTTCCCCTCCCCGCTCAAAATTGAAAACCATTAAAAAAAAAAAATTTCCCAGACAAAAATAAAAAATATTATTTGAGTGGGGGTGTTACGACAAAAAGGTTTCGGCGAAGGGGGGCCGATCTTCC
Full Trace Sequence: TGGCAGGAAACAGCTTATGACCATGTAATACGACTCACTATTAGGGGATACCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTCTTCGCTATGCTCGCCACCGCTTTCTTTGCTGCGTCATCCAGGTCGTTGGCAGAGGTAATGGGGAGCCCACTTTCTGCCAGAATTCGCTTGGCTTCGTGGACATTCGTTCCTTCTAGTCTGACCACCAAGGGAACCTTCAGTTCAAGCTCTCTGCAGGCCTTCGTTATCCCATTAGCTATAATTGCGCAGTTAACAATCCCTCCGAATATGTTGACAAGGATCGCTTCAACCCTGGGATCTGCAGTGAGCAGCTTGAAGGCTTGGTATACTTGCGACTCTTTCACACCACCGCCAAGATCAAGGAAGTTGGCTGGTTTTCCTCCATGCAAGTCAATGATATCACATGTTGCCATTGCGAGGCCCGCACCATTTACAAAGCAAGCTATGTTTCCATCCAAGCCGATATACTTCAAATCGTAACTGTTGGCTTCGTTCTCTATCGGGTCCATCTCCAAAGTGTTGTCCATGGCAAAGATCTCTTTTTGTCGGAATTCTGCATTGTCATCAAAGTTAATCTTGGCATCAAAGCACACAACTTGTCCTTCTGGAGTTTCTCCGAATGGGTTGATCTCGACTTGCGTGGCGTCCACTTTCAGGAAAAGAACGTACAGCCTCTTAATTTGCTCGGCAGCCTGCTGGTGAAGGGGTCCTTTAAATCCTAAATTGTCGGCGATCGGCAACGCCTGGCGGTCTTTTACACCTTCCAAAAATGTCAATTTCCTCCTTAAAAATAATTTCAGGTGTTTCGTCGCCACCTCGCCAATGTCCAATTGGCCCTTAAGACTTCGACTAAAAAAGGACCATAAGAACCTCGTTCCATTAAAAACCCAAATAAGTTTTTTCTGGAGTGTCTCGGAGCGTGGCGAGACCTTACTTTTGAAACTAGAGGGGGTCGACCTGCCGCCTGGTTTGGGTGGTGAAAGGAGGGGCAAACAATTAGTTTGGGTGGTTGGGGTGGAGGTTGCCTCGGTTTTTTAGTAGAAATAGAAACCCGCGCCTACGGCCCGCCGCTTCCAAAGTCTCGCGTTGCCCTTTTTCCCCTCCCCGCTCAAAATTGAAAACCATTAAAAAAAAAAAATTTCCCAGACAAAAATAAAAAATATTATTTGAGTGGGGGTGTTACGACAAAAAGGTTTCGGCGAAGGGGGGCCGATCTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCTTCGCTATGCTCGCC