ORFeome > tbccd1 ORF1 – XORFeome v1.0

tbccd1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tbccd1
Gene ID: 6252749
Gene Page ID: 5736156
ORF Xenbase ID: 17300115

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124991
Original XGC clone length: 1644

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ837505
dbEST ID: 79655207
Trimmed Sequence: ATGGATGGTAGTAGGGTCCAGCTATGGGCGAAAACCGATCCTTTTTTGCTGGGCGCGTTGCAGATGCCTCCCCCTGCTAAGTTCAGCATGCATTATTTGCGGAAAATGGCTTCATACGTGAGAACCCGTGCCACTGAAGGCTGCTATCCAAGGCTCTATTGGGCCATGTGGCGGCACATCGCCTGTGGCAAACTGCAGATTGTGGAGGAGACAGCCTGGCTTTACTTTGAAACGTTTCTCAGCGTTTTTGAGCGCAGTGTCGCTCAGAGCCTGGATTGGGCTGAAGTTGCTTCTACTTGTCCATCGTCAGAGAAGTATGAGGAGATAAAGAGTCAGCTTTCTGTGGATACCCTGAAGTTCATCCTTTTCCTCTACATTCAGCAAATAAATAAAATTTCTTTGCGGGCACCTATGATTGAGAGTGAGTGGCCCAGTCCAAGAAGCAGATCTCCTACTCCTGATTTTGTTGCACAGTCAAGCATCTATAATAAGGTCTGGGATGATTATAGTCATTATAACTTCATACACAATCATTTAACGTATATCCTGGAGTTGTTGATGGAACCTAAACAGCTCTCTATAGTAACCCAATCCTCTCACTGCATCCTGATATCCGCTGAAGTTGTTAATGCCCTTGGATTTCTTATT
Full Trace Sequence: GGTCTGGNAAATTACTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGGTAGTAGGGTCCAGCTATGGGCGAAAACCGATCCTTTTTTGCTGGGCGCGTTGCAGATGCCTCCCCCTGCTAAGTTCAGCATGCATTATTTGCGGAAAATGGCTTCATACGTGAGAACCCGTGCCACTGAAGGCTGCTATCCAAGGCTCTATTGGGCCATGTGGCGGCACATCGCCTGTGGCAAACTGCAGATTGTGGAGGAGACAGCCTGGCTTTACTTTGAAACGTTTCTCAGCGTTTTTGAGCGCAGTGTCGCTCAGAGCCTGGATTGGGCTGAAGTTGCTTCTACTTGTCCATCGTCAGAGAAGTATGAGGAGATAAAGAGTCAGCTTTCTGTGGATACCCTGAAGTTCATCCTTTTCCTCTACATTCAGCAAATAAATAAAATTTCTTTGCGGGCACCTATGATTGAGAGTGAGTGGCCCAGTCCAAGAAGCAGATCTCCTACTCCTGATTTTGTTGCACAGTCAAGCATCTATAATAAGGTCTGGGATGATTATAGTCATTATAACTTCATACACAATCATTTAACGTATATCCTGGAGTTGTTGATGGAACCTAAACAGCTCTCTATAGTAACCCAATCCTCTCACTGCATCCTGATATCCGCTGAAGTTGTTAATGCCCTTGGATTTCTTATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGGTAGTAGGGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837504
dbEST ID: 79655206
Trimmed Sequence: GGAAACAAGGCTGTCCAACTGGTGTCTATTTTCTGTCTTTGAAAGCCATTCGTTAAATTTCATTTCCACGACTGCTTGAAACTGTTTTCTCTGCTCCCTTGTTAAACCAGCATCTTTGACTGTTTTCTGCCATGTGTGTATCTTTTGTTGTCTTTGCTGCACAGAATTTGAGTAGGCTGGAGGAAGGCCTCCAGGAATTTCAGTTGTGTCACCTTCCATTTCAAAAGGTACAACAAAAGTAAAAAAATCTTCAGGTGGCATAAGTCTCCAAATATTGGAATTATTGCTCTCTGTAGAAAAAAGGAAAGGTCTATCCCACGAGTTTGGTACCGTAGCTAGTCCGGTCTGTGCCATGTGATCTTCTAGCATTGAATACCGAATATGAAAAGGAGCAAGTACAGCACCTTGATTCCCACAATAAAAAAGAGGTCTGGTAGGAGTCAGAATATGAAAAGTACAGTTGGTTGTAGATAAAAGAGACAAACGTTGACAAACAGCAATGATCTTTACATTGTAACACATCTGAATATGAAGAACAGTCTGCACAGGCCCAAGGATGATTGTGCAATTTTGGCATTTCTCAACAGTCACAGATCTTAATGGAGATAAAAGATATATA
Full Trace Sequence: GGAAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAAACAAGGCTGTCCAACTGGTGTCTATTTTCTGTCTTTGAAAGCCATTCGTTAAATTTCATTTCCACGACTGCTTGAAACTGTTTTCTCTGCTCCCTTGTTAAACCAGCATCTTTGACTGTTTTCTGCCATGTGTGTATCTTTTGTTGTCTTTGCTGCACAGAATTTGAGTAGGCTGGAGGAAGGCCTCCAGGAATTTCAGTTGTGTCACCTTCCATTTCAAAAGGTACAACAAAAGTAAAAAAATCTTCAGGTGGCATAAGTCTCCAAATATTGGAATTATTGCTCTCTGTAGAAAAAAGGAAAGGTCTATCCCACGAGTTTGGTACCGTAGCTAGTCCGGTCTGTGCCATGTGATCTTCTAGCATTGAATACCGAATATGAAAAGGAGCAAGTACAGCACCTTGATTCCCACAATAAAAAAGAGGTCTGGTAGGAGTCAGAATATGAAAAGTACAGTTGGTTGTAGATAAAAGAGACAAACGTTGACAAACAGCAATGATCTTTACATTGTAACACATCTGAATATGAAGAACAGTCTGCACAGGCCCAAGGATGATTGTGCAATTTTGGCATTTCTCAACAGTCACAGATCTTAATGGAGATAAAAGATATATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAAACAAGGCTGTCCAA