ORFeome > tbcel ORF1 – XORFeome v1.0

tbcel ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tbcel
Gene ID: 866587
Gene Page ID: 854924
ORF Xenbase ID: 17300127

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106427
Original XGC clone length: 1275

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ837936
dbEST ID: 79655638
Trimmed Sequence: ATGGATCCATCTTGTGGAAGGAGCTTTATGCAGGTCCTGTGTGAGAAGTACAGCCCGGAAAACTTCCCATATAGAAGGGGTCCAGGAGCCGGGGTTCATGTTCCCCCTGGACCACAGGTGTCTCCTATGAAAGACCGGCTCAATCTCCCCAGTATCCTGGTTATAAACAGTTGTGGCATCAACTGCGCTGGAGATGAAAGCGAGATTGCTGCATTTTGCTCTCATGTATCAGAACTGGATCTCTCTGGTAACAAGCTTGATGACTGGGAGGAGGTCAGCAAGATTGTTTCCAGTGTTCCCCAGCTACAGTTCCTGAATCTGAGTTCCAACCCACTGCACCTCTCCGTTTTAGGACGTTCATGTGCTGGGACATTCGCTAGCATTCGCAAGCTGGTTCTCAATAACTGCAAAGCTTCTTGGGAAACAGTCCATACACTGTTGATGGAGCTGCCAGAGTTGGAGGAGCTCTTTCTGTGCCTTAATGACTATAACACAGTATTATGTTCACCAGTCTGCTACCGCTCACTGAAGCTTCTCCACATAACTGACAACAACCTCCAGGATTGGTCAGAGATCCGCAAATTANGCACAATGTTTCCATGTCTGGACACTCTTGTTCTTGCAAATAACAACCTATCAAAGATTGAGGACTCAGAGGAGTCTCTACCAAGGCTGTTCCCAAAACTAAGGTCAATAAGTCTGCATAAAGCAAGTTTGGAACTCCGGGGCGTGACCTTTGAAAAACTAAATGCTTTTACCTAAACTTTGAAAAGGTTCAAAATTATTAAGATTTTTCCTTTTGGGTGAAACCCC
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCCATCTTGTGGAAGGAGCTTTATGCAGGTCCTGTGTGAGAAGTACAGCCCGGAAAACTTCCCATATAGAAGGGGTCCAGGAGCCGGGGTTCATGTTCCCCCTGGACCACAGGTGTCTCCTATGAAAGACCGGCTCAATCTCCCCAGTATCCTGGTTATAAACAGTTGTGGCATCAACTGCGCTGGAGATGAAAGCGAGATTGCTGCATTTTGCTCTCATGTATCAGAACTGGATCTCTCTGGTAACAAGCTTGATGACTGGGAGGAGGTCAGCAAGATTGTTTCCAGTGTTCCCCAGCTACAGTTCCTGAATCTGAGTTCCAACCCACTGCACCTCTCCGTTTTAGGACGTTCATGTGCTGGGACATTCGCTAGCATTCGCAAGCTGGTTCTCAATAACTGCAAAGCTTCTTGGGAAACAGTCCATACACTGTTGATGGAGCTGCCAGAGTTGGAGGAGCTCTTTCTGTGCCTTAATGACTATAACACAGTATTATGTTCACCAGTCTGCTACCGCTCACTGAAGCTTCTCCACATAACTGACAACAACCTCCAGGATTGGTCAGAGATCCGCAAATTANGCACAATGTTTCCATGTCTGGACACTCTTGTTCTTGCAAATAACAACCTATCAAAGATTGAGGACTCAGAGGAGTCTCTACCAAGGCTGTTCCCAAAACTAAGGTCAATAAGTCTGCATAAAGCAAGTTTGGAACTCCGGGGCGTGACCTTTGAAAAACTAAATGCTTTTACCTAAACTTTGAAAAGGTTCAAAATTATTAAGATTTTTCCTTTTGGGTGAAACCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCCATCTTGTGGAAGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837935
dbEST ID: 79655637
Trimmed Sequence: TTTGATTTTGGGTTCCACATAAAATTTGTCTCCATCATGAACATTATATGAATGTAAACGGCGGGTGCTGGATTTCATTTCCTCAGGGCCAAAAGGGGCTTCATGGTCTAGAAAGTACAGGCGCATGTTGTTGGTGGAGAGCTGCACCAAATTCTTCAGCTGTTTCTTGAACTCGGCCACAGTCTGATCTAAACGGATGCTCATCGTCTCCACTTTCTCTTCAAAGTGTATGTAGACATTGGCTTTGTTCTGGGGTCGAAGATCCACTTCTACGAGAGGTTCTAACTTTCCATACTTTGTCACCAGCTCTTGATATCTTAATGGGACATCTTCCTTTGGGAGATTCATATAGTAACGCAGGAAGAATCTTTCAGAGTCTTCTCTTTCACCATCCGTGACAACACTGCCATTCAGTTTGGATACAGACGGCAATCTTGCTATCACAAGTTTCCTGCGTTCTTCTGTGGTATATGGCTCCACCAAAGGAATACCTAATAATCTGACCTCTTCAAGTTTAGGTAAAGCATTTAGTTTTTCAATGTCACGCCAGGAGTTCAAACCTGCTTTATGCAGACTTATTGAACGTTAGTTTTGGGAACAGCCCTTGGTAGAGACTCGTCTGAGTCCTCAATCCTTTGATAGGTTGTTATTTTGCAAGATCAAAATGTTCCAAACTGGGAAACATTGGGCCCTAATTTGCCGGACTTCTACCCAAATCCCTGAAAGGTTTTTGTCAGGTTAATTTGGGAAAAACCTTCTAGTTGAACCGTTTTC
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGATTTTGGGTTCCACATAAAATTTGTCTCCATCATGAACATTATATGAATGTAAACGGCGGGTGCTGGATTTCATTTCCTCAGGGCCAAAAGGGGCTTCATGGTCTAGAAAGTACAGGCGCATGTTGTTGGTGGAGAGCTGCACCAAATTCTTCAGCTGTTTCTTGAACTCGGCCACAGTCTGATCTAAACGGATGCTCATCGTCTCCACTTTCTCTTCAAAGTGTATGTAGACATTGGCTTTGTTCTGGGGTCGAAGATCCACTTCTACGAGAGGTTCTAACTTTCCATACTTTGTCACCAGCTCTTGATATCTTAATGGGACATCTTCCTTTGGGAGATTCATATAGTAACGCAGGAAGAATCTTTCAGAGTCTTCTCTTTCACCATCCGTGACAACACTGCCATTCAGTTTGGATACAGACGGCAATCTTGCTATCACAAGTTTCCTGCGTTCTTCTGTGGTATATGGCTCCACCAAAGGAATACCTAATAATCTGACCTCTTCAAGTTTAGGTAAAGCATTTAGTTTTTCAATGTCACGCCAGGAGTTCAAACCTGCTTTATGCAGACTTATTGAACGTTAGTTTTGGGAACAGCCCTTGGTAGAGACTCGTCTGAGTCCTCAATCCTTTGATAGGTTGTTATTTTGCAAGATCAAAATGTTCCAAACTGGGAAACATTGGGCCCTAATTTGCCGGACTTCTACCCAAATCCCTGAAAGGTTTTTGTCAGGTTAATTTGGGAAAAACCTTCTAGTTGAACCGTTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGATTTTGGGTTCCACAT