ORFeome > tmem18 ORF1 – XORFeome v1.0

tmem18 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem18
Gene ID: 6254285
Gene Page ID: 5729342
ORF Xenbase ID: 17301321

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097804
Original XGC clone length: 411

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: A01

Sequences - 5สน (forward) EST

Accession: JZ838393
dbEST ID: 79656095
Trimmed Sequence: ATGGCGGAGGAGCCGGGAGTGTGGAGCTTGCTGGAACGGGCGCCCATTGACTGGACAGAACCATGGCTGATTGGACTTGCTGCTTTTCACATACTGTGCTTCATAGTCACATATATTTCTTTTAAATCATACCCACTTCAGATTTGCCATTTTTTGCTAATGGTTGTCCTTGTAAGTTGTGCTGAATATATCAATGAATTTGCGGCAATGCACTGGAGAGCATATTCAAAACAACAATATTTTGATTCAAGTGGAATGTTTATTTCCTTGGCATTTTCTGCACCTTTATTGTGTAACACTATAATTATTGTGGTCCATTGGGTATATAAGACATTATGTGTTATGACTGAACTGAAAACGTTGCAGCAAAAAAGAAAAGAATCAAGGGAGAAAAGAAAGAAAAAGGAATT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGGAGCCGGGAGTGTGGAGCTTGCTGGAACGGGCGCCCATTGACTGGACAGAACCATGGCTGATTGGACTTGCTGCTTTTCACATACTGTGCTTCATAGTCACATATATTTCTTTTAAATCATACCCACTTCAGATTTGCCATTTTTTGCTAATGGTTGTCCTTGTAAGTTGTGCTGAATATATCAATGAATTTGCGGCAATGCACTGGAGAGCATATTCAAAACAACAATATTTTGATTCAAGTGGAATGTTTATTTCCTTGGCATTTTCTGCACCTTTATTGTGTAACACTATAATTATTGTGGTCCATTGGGTATATAAGACATTATGTGTTATGACTGAACTGAAAACGTTGCAGCAAAAAAGAAAAGAATCAAGGGAGAAAAGAAAGAAAAAGGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAAGCTGTTTCCAAAAAAAACAAAAAAAAAAGACTCAAAATCCCTCGAATGTTACACCGGCCCCCCCGCGCGCGGTTAAAAAACCCCCTCCTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGGAGCCGGGA

Sequences - 3สน (reverse) EST

Accession: JZ838392
dbEST ID: 79656094
Trimmed Sequence: TTCCTTTTTCTTTCTTTTCTCCCTTGATTCTTTTCTTTTTTGCTGCAACGTTTTCAGTTCAGTCATAACACATAATGTCTTATATACCCAATGGACCACAATAATTATAGTGTTACACAATAAAGGTGCAGAAAATGCCAAGGAAATAAACATTCCACTTGAATCAAAATATTGTTGTTTTGAATATGCTCTCCAGTGCATTGCCGCAAATTCATTGATATATTCAGCACAACTTACAAGGACAACCATTAGCAAAAAATGGCAAATCTGAAGTGGGTATGATTTAAAAGAAATATATGTGACTATGAAGCACAGTATGTGAAAAGCAGCAAGTCCAATCAGCCATGGTTCTGTCCAGTCAATGGGCGCCCGTTCCAGCAAGCTCCACACTCCCGGCTCCTCCGCCATGG
Full Trace Sequence: CGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCTTTTTCTTTCTTTTCTCCCTTGATTCTTTTCTTTTTTGCTGCAACGTTTTCAGTTCAGTCATAACACATAATGTCTTATATACCCAATGGACCACAATAATTATAGTGTTACACAATAAAGGTGCAGAAAATGCCAAGGAAATAAACATTCCACTTGAATCAAAATATTGTTGTTTTGAATATGCTCTCCAGTGCATTGCCGCAAATTCATTGATATATTCAGCACAACTTACAAGGACAACCATTAGCAAAAAATGGCAAATCTGAAGTGGGTATGATTTAAAAGAAATATATGTGACTATGAAGCACAGTATGTGAAAAGCAGCAAGTCCAATCAGCCATGGTTCTGTCCAGTCAATGGGCGCCCGTTCCAGCAAGCTCCACACTCCCGGCTCCTCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCACTCAGAATAAAATCATTATTTGGGGCCCGACCTTAAGAAGAAAAAAACAAAAAAAACATCAATGACTGGAAGGCCCCTCGCGGGCCCCAAGAAAGAAAAACGGCGCCCTCTGCGCAAACAAGCGGGGTTTTCTGTGGAAAAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTTTTTCTTTCTTTTCTCCCT