ORFeome > tmem220 ORF1 – XORFeome v1.0

tmem220 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem220
Gene ID: 6254287
Gene Page ID: 972847
ORF Xenbase ID: 17301429

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC097768
Original XGC clone length: 555

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ838455
dbEST ID: 79656157
Trimmed Sequence: ATGGAGGGGTCAGGTACAGAGCAGAAGGGCTCCCCCAAGTGCAGCTTTCTGACAAACTCACTTTTGTGCCATGAAAACAGACAGAGGTTATGGAGGATCTGCAATTTTATTATGTTTGGGTTTTTCAGTCTGGCAGCTTACGTGCAAATAAATGACCCTGATGCAGAAATGTGGATTGTAATATATATGATCCCAGCGGTACTGATTCTCTTCGTTAGTATAAAGCCGGACATTACAGGTCACGTGATCTGGAAATTGCTAGCGGATCTGCATTCTGCCGTTTGTGCAGTTGGTGCCATCTACCTCTCTGGGTGCCTGTATTTCTACACTTCAAAAAACATCTTGCATGAAGAGGAAGGCAGGGAACTTTCAGGCCTGTTGATAATTAGTGGATGGTTACTTCTCTGCAGGAAATCACATCANTCGGCCATTGGTGCAATCAGGCTCATTATTGCCATTTCGGTTTCAACTGCCCCCTTTTTCATTTGGATCTACATTTATATTGACAAGGAAATGCGAACGTCCTGGCCACAGCACTGAAAAACTGTCATCTT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGGGTCAGGTACAGAGCAGAAGGGCTCCCCCAAGTGCAGCTTTCTGACAAACTCACTTTTGTGCCATGAAAACAGACAGAGGTTATGGAGGATCTGCAATTTTATTATGTTTGGGTTTTTCAGTCTGGCAGCTTACGTGCAAATAAATGACCCTGATGCAGAAATGTGGATTGTAATATATATGATCCCAGCGGTACTGATTCTCTTCGTTAGTATAAAGCCGGACATTACAGGTCACGTGATCTGGAAATTGCTAGCGGATCTGCATTCTGCCGTTTGTGCAGTTGGTGCCATCTACCTCTCTGGGTGCCTGTATTTCTACACTTCAAAAAACATCTTGCATGAAGAGGAAGGCAGGGAACTTTCAGGCCTGTTGATAATTAGTGGATGGTTACTTCTCTGCAGGAAATCACATCANTCGGCCATTGGTGCAATCAGGCTCATTATTGCCATTTCGGTTTCAACTGCCCCCTTTTTCATTTGGATCTACATTTATATTGACAAGGAAATGCGAACGTCCTGGCCACAGCACTGAAAAACTGTCATCTTGCCAACTTTCTTGTACAAAGTTGGCATTAATAGAAAGCATTGCTCATCAATTTGGTTCAACGAAAAAGTCACAATCAATTCAAATAAAAATCATTAATTGCCCATCCAAACTAATATCCCCCATTAATGGAGTCCTAATTACATGGTCCTTGGGAAAAAAAAAAAAAAAAAAACAAGAAAACAAGGCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGGTCAGGTACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838454
dbEST ID: 79656156
Trimmed Sequence: GATGACAGTTTTACAGTGCTGTGGCCAGGACGTTCGCATTTCCTTGTCAATATAAATGTAAATCCAAATGAAAAAGGGGGCAGTTGAAACCGAAATGGCAATAATGAGCCTGATTGCACCAATGGCCGACTGATGTGATTTCCTGCAGAGAAGTAACCATCCACTAATTATCAACAGGCCTGAAAGTTCCCTGCCTTCCTCTTCATGCAAGATGTTTTTTGAAGTGTAGAAATACAGGCGCCCGGAGAGGGTGATGGCGCCAACTGCGCGAGCGGCGGAATGCAGATCCTCTAACAATTTCCATATCACGTGACCTGTGAGGTCCGGCTGGTTACTAATCAGAAAAATCAGTACGGCTGGGAGGCTACATGTTGCAAGCCACAGTTCTTGCGGAGGGGGGGTTATTTTGTGGGGGAGCTCGCGGAGTGAGAAGCCCAACCGGACTAAAATTGTCTCGGGTTCGGGACCTCTCTCTGTTTTGTTGTTCGGGGGANGGGGGGGGGGGGGGGGGGGAGAGTTGGAGGAGGCGGGGCCCCCCTGGGTGAGGGCGGGGGGGGGGGAGGGGGGTGTTTAGTTTGAAGGGAGGCGGGGGGAGAAAACAATACTGCGGGGGGATAATTGGGGGGGGGGGAAATAAGGGGGCGGCGGCCATGCGNGGGGGGAGGAAAGAAAAAAAAAAAAAAGAAAAAGAAAAAAAAAAAATGTGGGGCCCGCGTTGGGCCCCCCCAAGAAAAAA
Full Trace Sequence: GGGGAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGACAGTTTTACAGTGCTGTGGCCAGGACGTTCGCATTTCCTTGTCAATATAAATGTAAATCCAAATGAAAAAGGGGGCAGTTGAAACCGAAATGGCAATAATGAGCCTGATTGCACCAATGGCCGACTGATGTGATTTCCTGCAGAGAAGTAACCATCCACTAATTATCAACAGGCCTGAAAGTTCCCTGCCTTCCTCTTCATGCAAGATGTTTTTTGAAGTGTAGAAATACAGGCGCCCGGAGAGGGTGATGGCGCCAACTGCGCGAGCGGCGGAATGCAGATCCTCTAACAATTTCCATATCACGTGACCTGTGAGGTCCGGCTGGTTACTAATCAGAAAAATCAGTACGGCTGGGAGGCTACATGTTGCAAGCCACAGTTCTTGCGGAGGGGGGGTTATTTTGTGGGGGAGCTCGCGGAGTGAGAAGCCCAACCGGACTAAAATTGTCTCGGGTTCGGGACCTCTCTCTGTTTTGTTGTTCGGGGGANGGGGGGGGGGGGGGGGGGGAGAGTTGGAGGAGGCGGGGCCCCCCTGGGTGAGGGCGGGGGGGGGGGAGGGGGGTGTTTAGTTTGAAGGGAGGCGGGGGGAGAAAACAATACTGCGGGGGGATAATTGGGGGGGGGGGAAATAAGGGGGCGGCGGCCATGCGNGGGGGGAGGAAAGAAAAAAAAAAAAAAGAAAAAGAAAAAAAAAAAATGTGGGGCCCGCGTTGGGCCCCCCCAAGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGACAGTTTTACAGTGCTGTGG