ORFeome > tnfrsf10b ORF1 – XORFeome v1.0

tnfrsf10b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tnfrsf10b
Gene ID: 6253239
Gene Page ID: 941759
ORF Xenbase ID: 17301819

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC123157
Original XGC clone length: 951

Human orthology & disease relationships

NCBI Entrez ID: 8795
Ensembl gene IDs: ENSG00000120889
Directly associated (OMIM) disease MIM numbers: 275355
Indirectly associated (Lage, et al.) disease MIM numbers: 142680,180849,275355,601859,603909,606843,607271,609446

Library Location

Plate ID: GDExl11087
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ838166
dbEST ID: 79655868
Trimmed Sequence: ATGGCCAAACTTACCTTCGGCTTCTTCTCCTTCTTGTTGGTGGTCTCCACTACCAATGGGCTGCCGTTACCCCCCGAGATGTATTACCAGGCTGGAAATATCCGATGTCTGCGATGCCCTGCAGGGACGTATGTGGGAATGCCATGCACAACGCAGGACACTGTGGGGAAATGCTTTCCCTGCCACACAGGGTCTTCATTTAGTGAAGGTTTCACTGGCCTGGACCACTGTCTCACCTGTTTGAGTTGTCGTGATGATCAGGAGGAGGTGAGACCCTGCACAGCCACTCAGAATGCTGAATGCCGTTGCAAGAAAGGGACGTACTGCCCCTTGGATCACCCGTGCGAAGTGTGTCTCACGTGTACCGAAAGCTGCCCCCCAGGCCACGAACTCCAGTTCCCGTGCAACTCCACTTCGGATAGTCACTGCGGACCTGCTCAAAGTGGATCGTGGATAATCGGGGTGTGTGTCCCAATTCTACTCATTCTACTGCTTCTGATTGGATTATGTCTGTGTAAACATCTAAAGTGGTGTAAAGATGGGCGCTCTCGAGTTCAAATGTCCATTTCTTTATGGACTGGAAACCCGGACAAAATAGAAATTCCCCTTATATCTCCGTGTTTGGTCTTCTCAGCACAAACAAAAAAAAAAAATACAAAAGCAATAATCCCGCCCATCTTGGAACCACTTTTGTGACCAGGTTCCAACCCCCCAAATGGGAACAAATCGGGGCGAACCTTTTTCCCCTTCACCCGATTTCTATA
Full Trace Sequence: GGGCGGGCCAGATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAAACTTACCTTCGGCTTCTTCTCCTTCTTGTTGGTGGTCTCCACTACCAATGGGCTGCCGTTACCCCCCGAGATGTATTACCAGGCTGGAAATATCCGATGTCTGCGATGCCCTGCAGGGACGTATGTGGGAATGCCATGCACAACGCAGGACACTGTGGGGAAATGCTTTCCCTGCCACACAGGGTCTTCATTTAGTGAAGGTTTCACTGGCCTGGACCACTGTCTCACCTGTTTGAGTTGTCGTGATGATCAGGAGGAGGTGAGACCCTGCACAGCCACTCAGAATGCTGAATGCCGTTGCAAGAAAGGGACGTACTGCCCCTTGGATCACCCGTGCGAAGTGTGTCTCACGTGTACCGAAAGCTGCCCCCCAGGCCACGAACTCCAGTTCCCGTGCAACTCCACTTCGGATAGTCACTGCGGACCTGCTCAAAGTGGATCGTGGATAATCGGGGTGTGTGTCCCAATTCTACTCATTCTACTGCTTCTGATTGGATTATGTCTGTGTAAACATCTAAAGTGGTGTAAAGATGGGCGCTCTCGAGTTCAAATGTCCATTTCTTTATGGACTGGAAACCCGGACAAAATAGAAATTCCCCTTATATCTCCGTGTTTGGTCTTCTCAGCACAAACAAAAAAAAAAAATACAAAAGCAATAATCCCGCCCATCTTGGAACCACTTTTGTGACCAGGTTCCAACCCCCCAAATGGGAACAAATCGGGGCGAACCTTTTTCCCCTTCACCCGATTTCTATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAAACTTACCTTCGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838165
dbEST ID: 79655867
Trimmed Sequence: ATTTTTGTCTACATAGTGTCCTTCCTGTAAAAGTTTTTGGACGATGGTTCTGGCTGGGGTGTGCAATTGAATGGAGTGCAGATAAAACAGCAGCTTATTGACATCTCCGGATTTCTGCTGGTGCCAGGCCTGGAGCATGGCAATCTTCTGCTCTCTGGAGTTGTCTCTGTTGTTTTCCTTGGCTTCACTCACAGAAATGGGAGAGAGGCACAACGTTCGCATGAATTGGTCCCATTTTGGCGTTGGCACCTGGTCAACAAAGTGGTCCCAAGATCGGCGGAATATTGCTTCTTGATCTTCTTTCTTTGTTTCTGCTGAGAAGACCAAACACGGAGATATAAGGGGAATTTCTACTTTGTCCGGGTTTCCAGTCCATAAAGAAATGGACATCTGAACTCGAGAGCGCCCATCTTTACACCACTTTAGATGTTTACACAGACATAATCCAATCAGAAGCAGTAGAATGAGTAGAATTGGGACACACACCCCGATTATCCACGATCCACTTTGAACAGGTCCGCAGTGACTATCCCAAATGGAGTTGCACGGGAACTGGAGTTCGTGGGCCTGGGGGGCAGGCTTTCGGTACACATTGAGACACACTTTCCCACGGGTGATCCGAAGGGGCAGTTACGTCCCTTTCTTTTGCACGGCTTTCAGGCATTCTAATTGGCCTGTGCAGGGTCTCGGCCCGCCCCCCCATCATCCCTAACCAACCTCAAAAAAGGTAAAAAAAAGGTGGGTCCAAGGGCCGGGGGGAAACACCTTTCA
Full Trace Sequence: GGGAAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTTTTGTCTACATAGTGTCCTTCCTGTAAAAGTTTTTGGACGATGGTTCTGGCTGGGGTGTGCAATTGAATGGAGTGCAGATAAAACAGCAGCTTATTGACATCTCCGGATTTCTGCTGGTGCCAGGCCTGGAGCATGGCAATCTTCTGCTCTCTGGAGTTGTCTCTGTTGTTTTCCTTGGCTTCACTCACAGAAATGGGAGAGAGGCACAACGTTCGCATGAATTGGTCCCATTTTGGCGTTGGCACCTGGTCAACAAAGTGGTCCCAAGATCGGCGGAATATTGCTTCTTGATCTTCTTTCTTTGTTTCTGCTGAGAAGACCAAACACGGAGATATAAGGGGAATTTCTACTTTGTCCGGGTTTCCAGTCCATAAAGAAATGGACATCTGAACTCGAGAGCGCCCATCTTTACACCACTTTAGATGTTTACACAGACATAATCCAATCAGAAGCAGTAGAATGAGTAGAATTGGGACACACACCCCGATTATCCACGATCCACTTTGAACAGGTCCGCAGTGACTATCCCAAATGGAGTTGCACGGGAACTGGAGTTCGTGGGCCTGGGGGGCAGGCTTTCGGTACACATTGAGACACACTTTCCCACGGGTGATCCGAAGGGGCAGTTACGTCCCTTTCTTTTGCACGGCTTTCAGGCATTCTAATTGGCCTGTGCAGGGTCTCGGCCCGCCCCCCCATCATCCCTAACCAACCTCAAAAAAGGTAAAAAAAAGGTGGGTCCAAGGGCCGGGGGGAAACACCTTTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTTTGTCTACATAGTGTCCTTC