ORFeome > tnni3 ORF1 – XORFeome v1.0

tnni3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tnni3
Gene ID: 865663
Gene Page ID: 486986
ORF Xenbase ID: 17301897

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082923
Original XGC clone length: 741

Human orthology & disease relationships

NCBI Entrez ID: 7137
Ensembl gene IDs: ENSG00000129991
Directly associated (OMIM) disease MIM numbers: 115210,611880,613286,613690
Indirectly associated (Lage, et al.) disease MIM numbers: 115210,115310,171300,192600,607482

Library Location

Plate ID: GDExl11004
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ839685
dbEST ID: 79657387
Trimmed Sequence: ATGTCTGATGAGGAAGAGGTGACCTATGAAGAAGAGGAGGAAGATTATGTTGAAGAAGAAGAAGAAGAAGAGGAAGTGGTGGCCCCTGAACCACCAAAACCTGCTCCTCCTCCTGCAGCTCCTCCACCTCTCATCCGCCGGCGCTCCTCCGCTAACTATCGGGCCTATGCCACAGAACCACAGGTTAAGATAAAACCCAAGATTTCTGCATCACGGAAGCTCCAGCTGAAGAGTTTGATGCTGCAGATTGCTAAGGCAGAAATGGAACATGAGGAAGAGGAGAGAGCTCTCGAGAAGGAGAGATACCTTGCAGAACAATGTCAGCCTCTACAACTGTCCGGCTTATCCCTCTCTGAACTGCAGGACCTGTGTCGGGAGCTTCATGCAAGAATCGATGTAGTAGATGAAGAAAGATATGACATGGAAGCCGAAGTGAACAAAAACATCACTGAGATCGAAGACTTGAATCTAAAGATCTTTGACCTCCGTGGCAAGTTCAAAAAGCCAAACCTCAGGAGGGTGCGCCTCTCTGCCGACGCCATGATGCGGGCGCTGTTGGGCACCAAGCACAAAGTCTCCATGGACCTACGGGCCAGTCTCAAACAGGTNCAGCAAACCAAAAAGGAAGATGTAGACNAGGATATAAGAGAAGTAGGTGACTGGGAGGAAGAATGTTGATGCACTGAGNTGGTATGGAGGGCAGGGAAGAAGAAGTTTTGATCCACCGGGGGGCTGGTTGCAGTTTTTGCCACTTTTCTGGTTCAAGGTTGGCCATTATTAAGAAACCATTGGCCTATCCATTTTGTTTGTCACCCAAAAAGGGTCCCTCTACAGTTCCAA
Full Trace Sequence: TCGGGGCCCCTATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGATGAGGAAGAGGTGACCTATGAAGAAGAGGAGGAAGATTATGTTGAAGAAGAAGAAGAAGAAGAGGAAGTGGTGGCCCCTGAACCACCAAAACCTGCTCCTCCTCCTGCAGCTCCTCCACCTCTCATCCGCCGGCGCTCCTCCGCTAACTATCGGGCCTATGCCACAGAACCACAGGTTAAGATAAAACCCAAGATTTCTGCATCACGGAAGCTCCAGCTGAAGAGTTTGATGCTGCAGATTGCTAAGGCAGAAATGGAACATGAGGAAGAGGAGAGAGCTCTCGAGAAGGAGAGATACCTTGCAGAACAATGTCAGCCTCTACAACTGTCCGGCTTATCCCTCTCTGAACTGCAGGACCTGTGTCGGGAGCTTCATGCAAGAATCGATGTAGTAGATGAAGAAAGATATGACATGGAAGCCGAAGTGAACAAAAACATCACTGAGATCGAAGACTTGAATCTAAAGATCTTTGACCTCCGTGGCAAGTTCAAAAAGCCAAACCTCAGGAGGGTGCGCCTCTCTGCCGACGCCATGATGCGGGCGCTGTTGGGCACCAAGCACAAAGTCTCCATGGACCTACGGGCCAGTCTCAAACAGGTNCAGCAAACCAAAAAGGAAGATGTAGACNAGGATATAAGAGAAGTAGGTGACTGGGAGGAAGAATGTTGATGCACTGAGNTGGTATGGAGGGCAGGGAAGAAGAAGTTTTGATCCACCGGGGGGCTGGTTGCAGTTTTTGCCACTTTTCTGGTTCAAGGTTGGCCATTATTAAGAAACCATTGGCCTATCCATTTTGTTTGTCACCCAAAAAGGGTCCCTCTACAGTTCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGATGAGGAAGAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839684
dbEST ID: 79657386
Trimmed Sequence: AACTGCAACAGCCCCAGTGGATTCAAACTTCTTCTTCCTGCCCTCCATACCACTCAGTGCATCAACATTCTTCCTCCAGTCACCTACTTCTCTTATATCCTTGTCTACATCTTCCTTTTTGGTTTGCTTGACCTGTTTGAGACTGGCCCGTAGGTCCATGGAGACTTTGTGCTTGGTGCCCAACAGCGCCCGCATCATGGCGTCGGCAGAGAGGCGCACCCTCCTGAGGTTTGGCTTTTTGAACTTGCCACGGAGGTCAAAGATCTTTAGATTCAAGTCTTCGATCTCAGTGATGTTTTTGTTCACTTCGGCTTCCATGTCATATCTTTCTTCATCTACTACATCGATTCTTGCATGAAGCTCCCGACACAGGTCCTGCAGTTCAGAGAGGGATAAGCCGGACAGTTGTAGAGGCTGACATTGTTCTGCAAGGTATCTCTCCTTCTCGAGAGCTCTCTCCTCTTCCTCATGTTCCATTTCTGCCTTAGCAATCTGCAGCATCAAACTCTTCAGCTGGAGCTTCCATGATGCAAAAATCTTGGGTTTTATCTTAACTTGTGGTTCTGTGGCATAGGCCCGATAATTAGCCGAAGAACGCCAGCGAATAAAAGTGAAGGAACTGCAGGAAGAAGACAAAGTTTTGGTGGTTCAGGGGCCACACGTTCCTCTTCTTCTTCTTCTTTCTTCAACATAATCTTTCTCCCTCTTCTCTCCTGGTGCACCTTGTTCCTGCATTGAAGAGATTGGCCCCAACTTTTTATTGGAAAGAAGTTTGGCCT
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACTGCAACAGCCCCAGTGGATTCAAACTTCTTCTTCCTGCCCTCCATACCACTCAGTGCATCAACATTCTTCCTCCAGTCACCTACTTCTCTTATATCCTTGTCTACATCTTCCTTTTTGGTTTGCTTGACCTGTTTGAGACTGGCCCGTAGGTCCATGGAGACTTTGTGCTTGGTGCCCAACAGCGCCCGCATCATGGCGTCGGCAGAGAGGCGCACCCTCCTGAGGTTTGGCTTTTTGAACTTGCCACGGAGGTCAAAGATCTTTAGATTCAAGTCTTCGATCTCAGTGATGTTTTTGTTCACTTCGGCTTCCATGTCATATCTTTCTTCATCTACTACATCGATTCTTGCATGAAGCTCCCGACACAGGTCCTGCAGTTCAGAGAGGGATAAGCCGGACAGTTGTAGAGGCTGACATTGTTCTGCAAGGTATCTCTCCTTCTCGAGAGCTCTCTCCTCTTCCTCATGTTCCATTTCTGCCTTAGCAATCTGCAGCATCAAACTCTTCAGCTGGAGCTTCCATGATGCAAAAATCTTGGGTTTTATCTTAACTTGTGGTTCTGTGGCATAGGCCCGATAATTAGCCGAAGAACGCCAGCGAATAAAAGTGAAGGAACTGCAGGAAGAAGACAAAGTTTTGGTGGTTCAGGGGCCACACGTTCCTCTTCTTCTTCTTCTTTCTTCAACATAATCTTTCTCCCTCTTCTCTCCTGGTGCACCTTGTTCCTGCATTGAAGAGATTGGCCCCAACTTTTTATTGGAAAGAAGTTTGGCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACTGCAACAGCCCCAGTGGA