ORFeome > tra2b ORF1 – XORFeome v1.0

tra2b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tra2b
Gene ID: 5864661
Gene Page ID: 5864556
ORF Xenbase ID: 17302233

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108873
Original XGC clone length: 897

Human orthology & disease relationships

NCBI Entrez ID: 6434
Ensembl gene IDs: ENSG00000136527
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ837271
dbEST ID: 79654973
Trimmed Sequence: ATGAGTGATAGCGGAGAGCAAAATTATGTCGATCGGGAATCAAGATCTGCGTCACGGAGTGGAAGTGGCCCAACAGTCTGGCAAGTCTGCAAGTCCGTCCCCGAATCGCTCAGCTGCCCGATCTCGTTCAAAAGAGGGATCCAGACGTTCCAAATCAAAATCCCGATCCAGATCTCATTCAAGGTCTAGATCAAGAAGAGGTTCTCGAAGACATTATACAAGGTCACGCACTCGCTCTAGGTCTCGGAAAAGATCAAGGAGCCGGTCACACAGTAGAGAATATAGAAGGCGTCACAGCCATAGTCACTCTCCTATGTCTTCTCGGCGAAGGCATATTGGAAACCGGGCAAATCCAGATCCTAACTGCTGTTTGGGAGTATTTGGTTTGAGTCTATATACTACAGAACGTGATCTGAGAGAAGTCTTTTCTAAATACGGTCCACTTAGTGACGTTTCCATAGTGTATGACCAGCAGTCAAGACGTTCAAGAGGATTCTCTTTTGTATATTTTGAAAATGTTGATGATGCGAAAGAGGCAAAAGAACGTGCTAATGGCATGGAACTTGATGGACGACGGCTACGTGTTGATTTCTCCATAACAAAACGGCCCCGTACCCCTACACCCAGGATCTTACATTGAAAGACCAACATATGGCAGTTCCCCGCCCCAAAATTCCTACCAACGGGGAAACCGACCCAACGGGAAAATGGGGACAAAAACTACAAACGCCAATCCACGAAGGGGGAGAGGAGG
Full Trace Sequence: GACCCCAAGTAATAGATTTTTATTTCTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGATAGCGGAGAGCAAAATTATGTCGATCGGGAATCAAGATCTGCGTCACGGAGTGGAAGTGGCCCAACAGTCTGGCAAGTCTGCAAGTCCGTCCCCGAATCGCTCAGCTGCCCGATCTCGTTCAAAAGAGGGATCCAGACGTTCCAAATCAAAATCCCGATCCAGATCTCATTCAAGGTCTAGATCAAGAAGAGGTTCTCGAAGACATTATACAAGGTCACGCACTCGCTCTAGGTCTCGGAAAAGATCAAGGAGCCGGTCACACAGTAGAGAATATAGAAGGCGTCACAGCCATAGTCACTCTCCTATGTCTTCTCGGCGAAGGCATATTGGAAACCGGGCAAATCCAGATCCTAACTGCTGTTTGGGAGTATTTGGTTTGAGTCTATATACTACAGAACGTGATCTGAGAGAAGTCTTTTCTAAATACGGTCCACTTAGTGACGTTTCCATAGTGTATGACCAGCAGTCAAGACGTTCAAGAGGATTCTCTTTTGTATATTTTGAAAATGTTGATGATGCGAAAGAGGCAAAAGAACGTGCTAATGGCATGGAACTTGATGGACGACGGCTACGTGTTGATTTCTCCATAACAAAACGGCCCCGTACCCCTACACCCAGGATCTTACATTGAAAGACCAACATATGGCAGTTCCCCGCCCCAAAATTCCTACCAACGGGGAAACCGACCCAACGGGAAAATGGGGACAAAAACTACAAACGCCAATCCACGAAGGGGGAGAGGAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGATAGCGGAGAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837270
dbEST ID: 79654972
Trimmed Sequence: ATAGCGACGTGGAGAGTATGAACGTGATCTAGAGCGAGATCTGTAGCCACCGCGGCTATAATATGGAGAAGGAGACCTCCTCCTAGAAAACTGGTCTCTGTCTTGTCCTCCACGCCATCCTCCTCCTCCTCCTCCACCACCACCACCTCCTCCCCCTCTGTAGGATCTGCTGTAGTAGTCTCTGTCGTCATATCCCCCTCGGTCGTATCCCCCATCGTAAGAATCTCTGCGCCGTGAACTGCCGTATGTTGGTCTTCCCATGTAGATTCCTGGTGTGGGTGGGGGGGGCCGTTTTGTTGTTAAGAAATCAACACGTAGGCGGGCGTCGGGGTAGTTGGTTGCGCGTAGCACCTTCTTTTTCGTCCTTCGCATCAACGTCTTTTTCTAAATATGGAAAAATAGAGCCGCGTCATCGTCTGGACGAGCGGGCAGACACTATNGAAACGGGACTCTTTGTTGGGTATTTAGAATGTACATCACCCCATCAAGAGTGCTAAGTTGTAGACGGCGGAGGGGGACTGCGTAGGCACCAGGAGGTTTTTGGTCTCCGCCACTGCGGGGGGGGCCTCGCCGAAAACACAAGAAAAAGAAGGGGGGGGGGGAAAACGGCTGGTTTCTTTCTCTGCTTTTGTGGGGGGGGGGCTGCGTCGATCCC
Full Trace Sequence: GCGTAGTCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAGCGACGTGGAGAGTATGAACGTGATCTAGAGCGAGATCTGTAGCCACCGCGGCTATAATATGGAGAAGGAGACCTCCTCCTAGAAAACTGGTCTCTGTCTTGTCCTCCACGCCATCCTCCTCCTCCTCCTCCACCACCACCACCTCCTCCCCCTCTGTAGGATCTGCTGTAGTAGTCTCTGTCGTCATATCCCCCTCGGTCGTATCCCCCATCGTAAGAATCTCTGCGCCGTGAACTGCCGTATGTTGGTCTTCCCATGTAGATTCCTGGTGTGGGTGGGGGGGGCCGTTTTGTTGTTAAGAAATCAACACGTAGGCGGGCGTCGGGGTAGTTGGTTGCGCGTAGCACCTTCTTTTTCGTCCTTCGCATCAACGTCTTTTTCTAAATATGGAAAAATAGAGCCGCGTCATCGTCTGGACGAGCGGGCAGACACTATNGAAACGGGACTCTTTGTTGGGTATTTAGAATGTACATCACCCCATCAAGAGTGCTAAGTTGTAGACGGCGGAGGGGGACTGCGTAGGCACCAGGAGGTTTTTGGTCTCCGCCACTGCGGGGGGGGCCTCGCCGAAAACACAAGAAAAAGAAGGGGGGGGGGGAAAACGGCTGGTTTCTTTCTCTGCTTTTGTGGGGGGGGGGCTGCGTCGATCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAGCGACGTGGAGAGTATGA