ORFeome > trub2 ORF1 – XORFeome v1.0

trub2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: trub2
Gene ID: 996205
Gene Page ID: 996198
ORF Xenbase ID: 17302557

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129715
Original XGC clone length: 990

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ838680
dbEST ID: 79656382
Trimmed Sequence: ATGGCTGAATTTGCGCCCAGTGTCCTGCGCACGTTACATGGGCTCTTCGCTGTGTATAAAGCTCCGGGGGTTCACTGGAAGTTGGTGCGGGATCAGGTGGAGACAAATCTGCTGAAAGAATTGAATGCCTTAAAGCAACGAGCCCCCCGTCATCAGATACGTTTCCTGCCAGCGGGTACAGAAGGGGGAAATGGGGTCCAGTTAACCCGAGTCCCCACTGCAGTTCCAGTCCTGGCTGATCATGTTCTGGTTAAAGGGCCGGCGTTCACTCGCCTCCTAGTTGGAGCAGGCCACAGGCTGGATGTTCAGTCCTCTGGGGTTTTTGTGCTGGGGTATGGACACGGCAACAAACTCCTGACGGATATGTACAACAGCCACTTCACCCGGGATTACACAGTACGGGGCAGATTTGGTAAAGCTACAGATGATTTCACAGAGCCAAGAAAGAATATTGAGAAAACCACATACAGTCACATTACAAAGGAGAAGCTGGAGAGGAATTTGGACTGGATTGATAGGGAAAGCCACAAGGCGTTGAAGATGCATTCCCGCGTGCAACTGAAAAACTAGGAAGGCGATGGACTAGAGGGAAGAAGGGAAACGGCGGACCAATAGGAAAAATGGCCGTCATAATTAGTTTAGGAAGTGGCTGGCGGTGGGGATGGGAGGAGACGGGATTCAAGATTGAAAAAAGAAGTAGGAAAGATGAGAGGGGGGCGTGGAAACTGGGACAGAAATGAATGAGAGAGAAACGGGAGATGGGAACTGCGGGGGGGCCGGCAATGTTGGCCACCCAGGG
Full Trace Sequence: TCGAGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAATTTGCGCCCAGTGTCCTGCGCACGTTACATGGGCTCTTCGCTGTGTATAAAGCTCCGGGGGTTCACTGGAAGTTGGTGCGGGATCAGGTGGAGACAAATCTGCTGAAAGAATTGAATGCCTTAAAGCAACGAGCCCCCCGTCATCAGATACGTTTCCTGCCAGCGGGTACAGAAGGGGGAAATGGGGTCCAGTTAACCCGAGTCCCCACTGCAGTTCCAGTCCTGGCTGATCATGTTCTGGTTAAAGGGCCGGCGTTCACTCGCCTCCTAGTTGGAGCAGGCCACAGGCTGGATGTTCAGTCCTCTGGGGTTTTTGTGCTGGGGTATGGACACGGCAACAAACTCCTGACGGATATGTACAACAGCCACTTCACCCGGGATTACACAGTACGGGGCAGATTTGGTAAAGCTACAGATGATTTCACAGAGCCAAGAAAGAATATTGAGAAAACCACATACAGTCACATTACAAAGGAGAAGCTGGAGAGGAATTTGGACTGGATTGATAGGGAAAGCCACAAGGCGTTGAAGATGCATTCCCGCGTGCAACTGAAAAACTAGGAAGGCGATGGACTAGAGGGAAGAAGGGAAACGGCGGACCAATAGGAAAAATGGCCGTCATAATTAGTTTAGGAAGTGGCTGGCGGTGGGGATGGGAGGAGACGGGATTCAAGATTGAAAAAAGAAGTAGGAAAGATGAGAGGGGGGCGTGGAAACTGGGACAGAAATGAATGAGAGAGAAACGGGAGATGGGAACTGCGGGGGGGCCGGCAATGTTGGCCACCCAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAATTTGCGCCCAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838679
dbEST ID: 79656381
Trimmed Sequence: TGCTCGTAGATCTCCTTCTCCCTCTGCTCCACTGATTGGCTCTGGGACGGGCCCCTCTGCAGCTTCTGTTTCTCTCATCGTGTTTGGGTTCCCTCTACTCACTTCATCAGATCGGGCCTTGCACTCCGTTATTGCCCTTTGAATGCTGCGGAGGTCCCAGTGAGTCCGGAGCAGGGCACAGTCCAGGGTAAAGGGTCCATCCCGAGTTCGACGCACCTGGGTGCAAATAGCAGATGAGCGCAGCTCCAACCCGATCTCGTGAATCATTTTGCGCAGGTACTGCTGCGTTTCATGCATGCACTGGATCTCAAGTGTGAAGTCAGGTGGTGAAAACTCAAGGCAGCGCACTCCTAGAATAATAGGAGGAGATTTCACCATTGGGCGGAGCTTCCCTTCTACCGCTAGTTCATAGGCCTCCTGGCTCTTCAGATCCACGCGGGAGTGCATAATCAACGCCTTGTGGTTGCTCCCTTGAGTCACAGCCCAGATCCTCTCCCGCTTCTCCCTTTGTATGTGAGGGTATGTGGTCGTCTCAATGGTTTTTCCTGGCTCTGGGGAATCATACTGTAGCTTTTACGAATCTGCCCCCCTACTGTGTATCCGCGCGGGAAGTGGAGGTGGTGGCTTTCCATCAAGAATTATGTGGCGGTGGGCATGCGCCGCCCCAACAACCCCAAAAAGAACTAAAAAAACAAACCTTTTCCCTTTGGCCCGGCCTGGTGTGCAAATTGGGGCGGCGGGGCCGTTTTAGCCGCGAAACCT
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTCGTAGATCTCCTTCTCCCTCTGCTCCACTGATTGGCTCTGGGACGGGCCCCTCTGCAGCTTCTGTTTCTCTCATCGTGTTTGGGTTCCCTCTACTCACTTCATCAGATCGGGCCTTGCACTCCGTTATTGCCCTTTGAATGCTGCGGAGGTCCCAGTGAGTCCGGAGCAGGGCACAGTCCAGGGTAAAGGGTCCATCCCGAGTTCGACGCACCTGGGTGCAAATAGCAGATGAGCGCAGCTCCAACCCGATCTCGTGAATCATTTTGCGCAGGTACTGCTGCGTTTCATGCATGCACTGGATCTCAAGTGTGAAGTCAGGTGGTGAAAACTCAAGGCAGCGCACTCCTAGAATAATAGGAGGAGATTTCACCATTGGGCGGAGCTTCCCTTCTACCGCTAGTTCATAGGCCTCCTGGCTCTTCAGATCCACGCGGGAGTGCATAATCAACGCCTTGTGGTTGCTCCCTTGAGTCACAGCCCAGATCCTCTCCCGCTTCTCCCTTTGTATGTGAGGGTATGTGGTCGTCTCAATGGTTTTTCCTGGCTCTGGGGAATCATACTGTAGCTTTTACGAATCTGCCCCCCTACTGTGTATCCGCGCGGGAAGTGGAGGTGGTGGCTTTCCATCAAGAATTATGTGGCGGTGGGCATGCGCCGCCCCAACAACCCCAAAAAGAACTAAAAAAACAAACCTTTTCCCTTTGGCCCGGCCTGGTGTGCAAATTGGGGCGGCGGGGCCGTTTTAGCCGCGAAACCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTCGTAGATCTCCTTCTCC