ORFeome > tsnax ORF1 – XORFeome v1.0

tsnax ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tsnax
Gene ID: 947713
Gene Page ID: 947706
ORF Xenbase ID: 17302623

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054180
Original XGC clone length: 894

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ839066
dbEST ID: 79656768
Trimmed Sequence: ATGTCTGCTAAAGGTTCGGGATCATTTAAAAACCGCAAACCTGATATTTTTCAAAGATCACAAAGAAAAGATGAGAAAGGCAGTGTTCACAGTTCCTCAGCAGTAGTAATGGCCTTTAAAGATTTTCAAAGTGAACTGGACGCAAGGCATGATAAATATGAACGACTTGTGAAACTTGGCCGGGATATAACGATTGAGAGCAAAAGGACAATTTTCCTGTTACACAGAATTATGAGTGATCATAATAAAGAAGATGTATTGTCTGAAGCAGAGACTAAATTACTTACCGTTCGTCAAAAAATAAGAGAAATTGCAGAGGAGTTGGTGGGAGAAGATATGTATCAGTATCACCGGGCATTTACACCAGGTCTTCAAGAGTATGTTGAAGCCATCACTTTCAAACATTTCATTGAGTCCAGAACACTTGTTACCATCAATGAAATTAACAAGCAGTTGATATTTGAAGGCTTGGAAAACATGCCTACAATAACAAGAGAGTCATTTTGCAGTAATTTATCATGTTCAACTGAGAACGACCATTCAAAAATAACTGCATTAAGAATCCAAGTTACACCTGTGGATTACCTACTTGGGGTAGCTGACCTTACTGGAGAATTAATGCGTTATTGTATAAGTAGTGTTGGAAACGGAGACATTGACACACCCTTTGAACTAAGTTGTTTCCTGCGCCAGGTCCTTTGAAGGATTCCCAAACCTTGGCAACACTGGGGCCATAGGAAATTTTCAAGAAAAAATCCTGGTTTTTAAAACCAAAATCCGGTCAAAAAGTTTGAAAAAAGGCTTGGGTTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGCTAAAGGTTCGGGATCATTTAAAAACCGCAAACCTGATATTTTTCAAAGATCACAAAGAAAAGATGAGAAAGGCAGTGTTCACAGTTCCTCAGCAGTAGTAATGGCCTTTAAAGATTTTCAAAGTGAACTGGACGCAAGGCATGATAAATATGAACGACTTGTGAAACTTGGCCGGGATATAACGATTGAGAGCAAAAGGACAATTTTCCTGTTACACAGAATTATGAGTGATCATAATAAAGAAGATGTATTGTCTGAAGCAGAGACTAAATTACTTACCGTTCGTCAAAAAATAAGAGAAATTGCAGAGGAGTTGGTGGGAGAAGATATGTATCAGTATCACCGGGCATTTACACCAGGTCTTCAAGAGTATGTTGAAGCCATCACTTTCAAACATTTCATTGAGTCCAGAACACTTGTTACCATCAATGAAATTAACAAGCAGTTGATATTTGAAGGCTTGGAAAACATGCCTACAATAACAAGAGAGTCATTTTGCAGTAATTTATCATGTTCAACTGAGAACGACCATTCAAAAATAACTGCATTAAGAATCCAAGTTACACCTGTGGATTACCTACTTGGGGTAGCTGACCTTACTGGAGAATTAATGCGTTATTGTATAAGTAGTGTTGGAAACGGAGACATTGACACACCCTTTGAACTAAGTTGTTTCCTGCGCCAGGTCCTTTGAAGGATTCCCAAACCTTGGCAACACTGGGGCCATAGGAAATTTTCAAGAAAAAATCCTGGTTTTTAAAACCAAAATCCGGTCAAAAAGTTTGAAAAAAGGCTTGGGTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGCTAAAGGTTCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839065
dbEST ID: 79656767
Trimmed Sequence: AATTCTGTCATCAATTTCAATTAACTCTGATTTGAAAGAAAACACATCAGCAAGCATATGTTTTGGAATCTCTGACCCTCTCACTTTTAATGCATAACAAGCATTCTCAACTTTTGACAGACTCTGTTTTAAAACATGGATCTTTCTTGAAATTTCATATGGCCCAGTGTTGCCAATGTATGCGAATCCATCAAAGACCTGGCGCAGGAAACAACTTAGCTCAAAGGGTGTGTCAATGTCTCCGTTTCCAACACTACTTATACAATAACGCATTAATTCTCCAGTAAGGTCAGCTACCCCAAGTAGGTAATCCACAGGTGTAACTTGGATTCTTAATGCAGTTATTTTTGAATGGTCGTTCTCAGTTGAACATGATAAATTACTGCAAAATGACTCTCTTGTTATTGTAGGCATGTTTTCCAAGCCTTCAAATATCAACTGCTTGTTAATTTCATTGATGGTAACAAGTGTTCTGGACTCAATGAAATGTTTGAAAGTGATGGCTTCAACATACTCTTGAAGACCTGGTGTAAATGCCCGGTGATACTGATACATATCTTCTCCCACCAACTCCTCTGCAATTTCTCTTATTTTTTGACAAACCGTAAATAATTTAGTCTCTGCTTCAAACAATACAATCTTCTTTATTAAGAATCACTCATAATTTCTGTGATAAAAGGAAAAATTGTCCTTTTTTCCTTCCAATTCGTTTAAATCCCGGGCAAAAGTTTTTCAAAAATTCGTTTTAAAATATTAATCAATGGCCC
Full Trace Sequence: GAGAGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATTCTGTCATCAATTTCAATTAACTCTGATTTGAAAGAAAACACATCAGCAAGCATATGTTTTGGAATCTCTGACCCTCTCACTTTTAATGCATAACAAGCATTCTCAACTTTTGACAGACTCTGTTTTAAAACATGGATCTTTCTTGAAATTTCATATGGCCCAGTGTTGCCAATGTATGCGAATCCATCAAAGACCTGGCGCAGGAAACAACTTAGCTCAAAGGGTGTGTCAATGTCTCCGTTTCCAACACTACTTATACAATAACGCATTAATTCTCCAGTAAGGTCAGCTACCCCAAGTAGGTAATCCACAGGTGTAACTTGGATTCTTAATGCAGTTATTTTTGAATGGTCGTTCTCAGTTGAACATGATAAATTACTGCAAAATGACTCTCTTGTTATTGTAGGCATGTTTTCCAAGCCTTCAAATATCAACTGCTTGTTAATTTCATTGATGGTAACAAGTGTTCTGGACTCAATGAAATGTTTGAAAGTGATGGCTTCAACATACTCTTGAAGACCTGGTGTAAATGCCCGGTGATACTGATACATATCTTCTCCCACCAACTCCTCTGCAATTTCTCTTATTTTTTGACAAACCGTAAATAATTTAGTCTCTGCTTCAAACAATACAATCTTCTTTATTAAGAATCACTCATAATTTCTGTGATAAAAGGAAAAATTGTCCTTTTTTCCTTCCAATTCGTTTAAATCCCGGGCAAAAGTTTTTCAAAAATTCGTTTTAAAATATTAATCAATGGCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATTCTGTCATCAATTTCAATTAA