ORFeome > tspo ORF1 – XORFeome v1.0

tspo ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tspo
Gene ID: 5863710
Gene Page ID: 5863587
ORF Xenbase ID: 17302731

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041505
Original XGC clone length: 495

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ823902
dbEST ID: 79641604
Trimmed Sequence: ATGACTTCCTGGGCTCCCGCTATCGGACTCTCGCTCCTCCCCCACGTGGGCGGCATAGTCGGGGGTTTAATAACGAGGAAAGAGGTGAAAACCTGGTACACGACCCTGGTGAAACCTTCCTGGCGCCCCCCCAACTGGATGTTTGGCCCCGTGTGGACCACATTATACACCTCCATGGGCTACGGCTCCTATCTGATCTATAAGGAACTGGGAGGACTGAATGAAAAGGCCGTGGTGCCCCTTGGACTGTATGCCGGCCAGCTGGCCCTCAACTGGGCATGGACTCCCATATTCTTTGGTGCCCACAAGATCGGCTGGGGGCTGGTGGATTTAGTTTTCCTCTGGGGGACCGCTGTGGCCACAACCCTATCTTGGCACCCCATTAGCCGGTCGGCAGCGTATCTGATGCTCCCGTATCTCGCGTGGCTCACGCTGGCGTCCGCCCTCAACTACTGCATCTGGAGGGACAACAAGAAGGAGGACAAGAGCGAGTT
Full Trace Sequence: AGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTTCCTGGGCTCCCGCTATCGGACTCTCGCTCCTCCCCCACGTGGGCGGCATAGTCGGGGGTTTAATAACGAGGAAAGAGGTGAAAACCTGGTACACGACCCTGGTGAAACCTTCCTGGCGCCCCCCCAACTGGATGTTTGGCCCCGTGTGGACCACATTATACACCTCCATGGGCTACGGCTCCTATCTGATCTATAAGGAACTGGGAGGACTGAATGAAAAGGCCGTGGTGCCCCTTGGACTGTATGCCGGCCAGCTGGCCCTCAACTGGGCATGGACTCCCATATTCTTTGGTGCCCACAAGATCGGCTGGGGGCTGGTGGATTTAGTTTTCCTCTGGGGGACCGCTGTGGCCACAACCCTATCTTGGCACCCCATTAGCCGGTCGGCAGCGTATCTGATGCTCCCGTATCTCGCGTGGCTCACGCTGGCGTCCGCCCTCAACTACTGCATCTGGAGGGACAACAAGAAGGAGGACAAGAGCGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCGTGTAAAAAAAAAAATATTTTAATATAAAAAAAAAAATTTTAATAACACCAAAAAATTTCCTTTTTCCCCATCGGGAACCCCCTCCCGGTCCCGGGGGGGGGGTTTATATATAACCCCTCGTGTACACTCCAAAAACAAAAAAAAAAACAAGAAACAAATTTTTTATTAAGGGTGGAAAAACTTTTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCCTGGGCTCCCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829211
dbEST ID: 79646913
Trimmed Sequence: CTCGCTCTTGTCCTCCTTCTTGTTGTCCCTCCAGATGCAGTAGTTGAGGGCGGACGCCAGCGTGAGCCACGCGAGATACGGGAGCATCAGATACGCTGCCGACCGGCTAATGGGGTGCCAAGATAGGGTTGTGGCCACAGCGGTCCCCCAGAGGAAAACTAAATCCACCAGCCCCCAGCCGATCTTGTGGGCACCAAAGAATATGGGAGTCCATGCCCAGTTGAGGGCCAGCTGGCCGGCATACAGTCCAAGGGGCACCACGGCCTTTTCATTCAGTCCTCCCAGTTCCTTATAGATCAGATAGGAGCCGTAGCCCATGGAAGTGTATAATGTGGTCCACACGGGGCCAAACATCCTGTTGGGGGGGCGCCAGGAAGGTTTCACCAGGGTCGTGTACCAGGTTTTCACCTCTTTCCTCGTTATTAAACCCCCGACTATGCGGCCCGCGTGGGGGAGGGACGAGAATCCTATAGCGGGAGCCCAGGAAGTAATGG
Full Trace Sequence: GGACGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGCTCTTGTCCTCCTTCTTGTTGTCCCTCCAGATGCAGTAGTTGAGGGCGGACGCCAGCGTGAGCCACGCGAGATACGGGAGCATCAGATACGCTGCCGACCGGCTAATGGGGTGCCAAGATAGGGTTGTGGCCACAGCGGTCCCCCAGAGGAAAACTAAATCCACCAGCCCCCAGCCGATCTTGTGGGCACCAAAGAATATGGGAGTCCATGCCCAGTTGAGGGCCAGCTGGCCGGCATACAGTCCAAGGGGCACCACGGCCTTTTCATTCAGTCCTCCCAGTTCCTTATAGATCAGATAGGAGCCGTAGCCCATGGAAGTGTATAATGTGGTCCACACGGGGCCAAACATCCTGTTGGGGGGGCGCCAGGAAGGTTTCACCAGGGTCGTGTACCAGGTTTTCACCTCTTTCCTCGTTATTAAACCCCCGACTATGCGGCCCGCGTGGGGGAGGGACGAGAATCCTATAGCGGGAGCCCAGGAAGTAATGGTGCCAACTTTTTTGAACAAGTTTGGCATAAAAAAAGGCATTGCTCATTAATTTGTGGCAACGAAGAGGGTTCCATCAGTCAAAATAAAAAATTTATTGGGGGCCCAAAAAAAAGAAGGGAGCGTGGTTTTAAAGGAGGGGGAGTGGGGAAATGCGGTGGGGGAGGCGGGTGTGGGGGGGGGGAGGGAGGGAGGAGTTGTTAAGGCGTAGGGGAAGTGATGGATAAGGTGGGGGAAGTTGAGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGCTCTTGTCCTCCT