ORFeome > uchl5 ORF1 – XORFeome v1.0

uchl5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: uchl5
Gene ID: 968747
Gene Page ID: 968742
ORF Xenbase ID: 17303559

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122495
Original XGC clone length: 990

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ838057
dbEST ID: 79655759
Trimmed Sequence: ATGGCGGGCAGTGCAGGAGAATGGTGCCTGATGGAGAGCGACCCCGGCGTGTTCACCGAACTGATCAAAGGGTTTGGATGCCCAGGTATTCAAGTAGAAGAAATCTGGAGTCTGGAACAAGAACACTTTGTAGACTTGCAACCAGTGCAAGGATTAATCTTTCTCTTCAAGTGGCAGCCAGGAGAGGAACCAGCTGGCTCTGTTGTTCAAGACTCCAGGCTGGACACAATCTTTTTTGCGAAACAGGTAATAAACAATGCATGTGCAACACAAGCAATCATCAGTATTTTGCTAAACACCACACACAATGATGTACATTTAGGAGAAACTCTGTCTGAATTCAAAGAATTCACCCAAAGCTTTGATGCAGCTATGAAAGGACTGGCTCTAAGCAATTCCGAAGTGATCCGTCAAGTACACAACAGTTTTGCCAGGCAACAAATGTTTGAGTTTGATGCAAAATCCACAACGAAGGATGATGATGCATTTCACTTTGTCAGCTACGTGCCAGTCAACGGGAGGCTTTACGAACTGGACGGTTTAGAGGATGGACCAATTGATTTAGGACCATGTAAGGAAGACGATTGGATCAGTGCAGCTAGACCTGTTATAGAGAAACGAATGCAGAAGTACTGTGAAGGTGAGATACGGTTCCATTTTGATGCTATTGTGTCAAACAGAAAAAGAACTACAAACAAAAAAATGCAGATTTTGCAAAGGCGAATTTCAAAAAAAAACCCAATGAAC
Full Trace Sequence: TTGGGGGCGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGCAGTGCAGGAGAATGGTGCCTGATGGAGAGCGACCCCGGCGTGTTCACCGAACTGATCAAAGGGTTTGGATGCCCAGGTATTCAAGTAGAAGAAATCTGGAGTCTGGAACAAGAACACTTTGTAGACTTGCAACCAGTGCAAGGATTAATCTTTCTCTTCAAGTGGCAGCCAGGAGAGGAACCAGCTGGCTCTGTTGTTCAAGACTCCAGGCTGGACACAATCTTTTTTGCGAAACAGGTAATAAACAATGCATGTGCAACACAAGCAATCATCAGTATTTTGCTAAACACCACACACAATGATGTACATTTAGGAGAAACTCTGTCTGAATTCAAAGAATTCACCCAAAGCTTTGATGCAGCTATGAAAGGACTGGCTCTAAGCAATTCCGAAGTGATCCGTCAAGTACACAACAGTTTTGCCAGGCAACAAATGTTTGAGTTTGATGCAAAATCCACAACGAAGGATGATGATGCATTTCACTTTGTCAGCTACGTGCCAGTCAACGGGAGGCTTTACGAACTGGACGGTTTAGAGGATGGACCAATTGATTTAGGACCATGTAAGGAAGACGATTGGATCAGTGCAGCTAGACCTGTTATAGAGAAACGAATGCAGAAGTACTGTGAAGGTGAGATACGGTTCCATTTTGATGCTATTGTGTCAAACAGAAAAAGAACTACAAACAAAAAAATGCAGATTTTGCAAAGGCGAATTTCAAAAAAAAACCCAATGAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGCAGTGCAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838056
dbEST ID: 79655758
Trimmed Sequence: TTTGGCTTCCTGAGCCCTCCTTGTGTTGTGTTTCTCTTTGGCCTTTTCTACTAATGGTATTAACTGCTGATGCTCTGCTAGAGTCTTCAGCAACTCCATGATGAATGGAAGGTAGTTATGTTTTCTTCTGATATTTTCAACCTTGTATCTTTTCATCTTTTGTTTCTCTTCTTCTATAAGCAGCTGGTATTTTGCGATTTCCGACTGCATGGAGCTCAGCAGAGTGCTGCCCTGGTCTGTGTCCATAGGCTCTTCCTCTGCAATTCGCCTCTGCAAATCTGCAATCTTCTGCTCGTAGATCTTCTTTCTGTCTGACACAATAGCCATCAAATTGAACCGTATCTCACCTTCACAGTACTTCTGCATTCGTTTCTCTATAACAGGTCTAGCTGCACTGATCCAATCGTCTTCCTTACATGGTCCTAAATCAATTGGTCCATCCTTTAAACCGTCCAGTTCGTAAAGCCTCCCGTTGACTGGCACGTAGCTGACAAAGTGAAATGCATCATCATCCTTCGTTGTGGATTTTGCATCAGACTCAAACATTTGTTGCCTGGCAAAACTGTTGTGTACTTGACAGATCACTTCGGAATTGCTTAGAGCCAATCCTTTCATAGCTGCCTCAAAAGCTTTGGGTGAATTCTTGAATTTCACACAAAATTTCTCGTAATGTCCTTCATTTTTGTGTGGGGGTTTGGCAAAAAACCGAAAAATTTCCTTTGGGTTCCCAAGTGCCTTGGTTAATT
Full Trace Sequence: GAAACCGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGGCTTCCTGAGCCCTCCTTGTGTTGTGTTTCTCTTTGGCCTTTTCTACTAATGGTATTAACTGCTGATGCTCTGCTAGAGTCTTCAGCAACTCCATGATGAATGGAAGGTAGTTATGTTTTCTTCTGATATTTTCAACCTTGTATCTTTTCATCTTTTGTTTCTCTTCTTCTATAAGCAGCTGGTATTTTGCGATTTCCGACTGCATGGAGCTCAGCAGAGTGCTGCCCTGGTCTGTGTCCATAGGCTCTTCCTCTGCAATTCGCCTCTGCAAATCTGCAATCTTCTGCTCGTAGATCTTCTTTCTGTCTGACACAATAGCCATCAAATTGAACCGTATCTCACCTTCACAGTACTTCTGCATTCGTTTCTCTATAACAGGTCTAGCTGCACTGATCCAATCGTCTTCCTTACATGGTCCTAAATCAATTGGTCCATCCTTTAAACCGTCCAGTTCGTAAAGCCTCCCGTTGACTGGCACGTAGCTGACAAAGTGAAATGCATCATCATCCTTCGTTGTGGATTTTGCATCAGACTCAAACATTTGTTGCCTGGCAAAACTGTTGTGTACTTGACAGATCACTTCGGAATTGCTTAGAGCCAATCCTTTCATAGCTGCCTCAAAAGCTTTGGGTGAATTCTTGAATTTCACACAAAATTTCTCGTAATGTCCTTCATTTTTGTGTGGGGGTTTGGCAAAAAACCGAAAAATTTCCTTTGGGTTCCCAAGTGCCTTGGTTAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGGCTTCCTGAGCCCTCCTT