ORFeome > wdr74 ORF1 – XORFeome v1.0

wdr74 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: wdr74
Gene ID: 969807
Gene Page ID: 969800
ORF Xenbase ID: 17304699

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129603
Original XGC clone length: 1131

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGCGGCCCCTATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGCCCGTTCGGAATCACGTGTGGGTAGGAACCGAGACTGGAATACTCAAAGGCATTAATCTTCAAAAAAAACAAGCTTTTAATTACACAGATGTGGCTTCCATAACTAAGGGCCAGGAGGTTACTGCCATGTGCTGGGGAGATCCACAAGAGTCTGAGGTTCTTCTCGGTTGTGGAGATGGCACAGTCAGAGTTTTTAGCAGCGAAAAATCCAAATTCACTGAAATTCATGAGTGCAGAGGAGGGGAAGGGACATTTAAAGGACTTGCTGTTATGGATAATGCTCTTGTAACATGCGTGGAGTCTGGACTCTTAAAAGTGTGGAAAGCTGGGGACTCTGATAATCTAAAGGTGCAGGTTGGAGCTGGGATTGAGAAGATGCGACAATGTGAAACTCAGCATCAGCGGAGTTGGAACAGGAGGCAGAGAAACTGACCTAAAAAATCTGGGAGTTGGAGAGACCTGAGGGCCCCGATTTGAAAAGTGAAGATGTAAGGAATGATGGGCGTGATCTCCCTGTGCCGGTATGAGAAGGGGATCTTGGATTCCGTTCAAGGAGCAGAGAAAAATGTAAACCGACCAGGGCCGCACCGGCTCGAAAAGAATAAAGAGAAACCGCGCGCGAAGACGATGGAATGTATTAATTTCTGGGGGGGAGAGAGGAGGGGCTGGGGGGCGGTGAGTATGGAAGGGTAAGGGGAAAGATGGATCAGTGGAGTGGAAAGTTCACATTAGGGAGAATGAAAGGGTAGGTAAACGAGGAGGAGAGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGCCCGTTCGGAAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838650
dbEST ID: 79656352
Trimmed Sequence: AGCACATTTCTTTTTTTTACGTGTGGGGTTTTTAGTTCCAGTCTCCGAATTAGCCCTAATTTGAACCTCCTGGCGTTTTTTGCTGGTTTTGTCTACCACTGTCTCCATGTTGTCCCACACTGCATCTTCCTCCTCCTTAACATCCTGTTCTGCAGGTGAAGTCGCATCTTCCTCCTCCCATTTTTCACGTGAAGTTAAGAGAAGGCAATTTAACTGCGACTTTAGATACACCTTGTGCAGCAGTTCTTTGTTCTGATAGTTGTGAATTCGGAGGAACCTATCCAGCCCACAGGAAGCCACAATAGGCATGGATGAGTGGCACTGGATGGAGCGTATGGATCCAGCACTTCCCTTGAGAGCGCACAGCAGTCGGCCTTTCCTCAGATCGATAACTGCCACATTGCCGCGGGAATTTCCAACAACGACAGACCTGCCATCTGGAGTGATACTCAGCGCAGTAAGTGGATCATCCTCATACAGAACCTCTAAGACTGGACGTCTCTCGGGGCTGCTTGGATCATATACTCTGACCTGGTGGTGACCTGTGCAGGTTACAATTTTCTCTTACCCCTGGAACGAATCCAGAATCCCTAATCCAAACCGGCACATGGAAGATCAGCCCATCATTGCCTTACTTTTTCAGCCTTAAAAAGGGGGGCCGGCCGGGCTCGGCCAAATCCCGAAATTTTTAGGGTCCGTCTTTTTGGCCTCCTGTTCCCAAATCACGTGGAGGCCTGAGGTTCCAAAATTGGGGCGGGATCTGTGCCCCATTCC
Full Trace Sequence: AAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCACATTTCTTTTTTTTACGTGTGGGGTTTTTAGTTCCAGTCTCCGAATTAGCCCTAATTTGAACCTCCTGGCGTTTTTTGCTGGTTTTGTCTACCACTGTCTCCATGTTGTCCCACACTGCATCTTCCTCCTCCTTAACATCCTGTTCTGCAGGTGAAGTCGCATCTTCCTCCTCCCATTTTTCACGTGAAGTTAAGAGAAGGCAATTTAACTGCGACTTTAGATACACCTTGTGCAGCAGTTCTTTGTTCTGATAGTTGTGAATTCGGAGGAACCTATCCAGCCCACAGGAAGCCACAATAGGCATGGATGAGTGGCACTGGATGGAGCGTATGGATCCAGCACTTCCCTTGAGAGCGCACAGCAGTCGGCCTTTCCTCAGATCGATAACTGCCACATTGCCGCGGGAATTTCCAACAACGACAGACCTGCCATCTGGAGTGATACTCAGCGCAGTAAGTGGATCATCCTCATACAGAACCTCTAAGACTGGACGTCTCTCGGGGCTGCTTGGATCATATACTCTGACCTGGTGGTGACCTGTGCAGGTTACAATTTTCTCTTACCCCTGGAACGAATCCAGAATCCCTAATCCAAACCGGCACATGGAAGATCAGCCCATCATTGCCTTACTTTTTCAGCCTTAAAAAGGGGGGCCGGCCGGGCTCGGCCAAATCCCGAAATTTTTAGGGTCCGTCTTTTTGGCCTCCTGTTCCCAAATCACGTGGAGGCCTGAGGTTCCAAAATTGGGGCGGGATCTGTGCCCCATTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCACATTTCTTTTTTTTACG