ORFeome > zp4 ORF2 – XORFeome v1.0

zp4 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zp4
Gene ID: 989719
Gene Page ID: 989712
ORF Xenbase ID: 17306109

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123370
Original XGC clone length: 1632

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ837539
dbEST ID: 79655241
Trimmed Sequence: ATGAGGGGACATGCAGGCTCTTGGGGTTTAGTGGTTGCATTGGGGCTCTGTTCTTTGCTTTCTTGTGTTCAGGGATTTTGGGATGGATTACACTGTGGGCCCACAAACATGCAGTTTTCAGTCCCTTCGCTTGTACAAGATGTTGCTTTTGTGCTGTCAGCTGTGGATCACACTGGAAAATCTCACTACCTTGCCAATAACACTGCTTGTGGTACCTGGGTAGGACAGAAATCAGATGGTTCGCTGGTGGTTGATGCTGCCTACGATGGGTGCTTTGTTCATGAGGAGAATGGTGACCATGTGATGACGGTTAGTCTTGAAGAGGTAATAAATGGACATGTTGACTACCATAAACAAGAACTCAAGTGCCCAGTCATGGAAGCTATGGATGTTCCCAGCCCAGATACATGTTCTGCCATCAAGAGAGAAGACAGGCTTTCATGTGCCAAGGCTCCTGTATCACAAGACCTCTGTCAAGGGTTGGGTTGCTGTTACACATCCAGTGATCCTACAATGCCTTGTTACTATGGGAATAAATTGACTGCCCAGTGCTCGACCGACAACAATATGATGGTTGCCATTTCAAAAGATCTGACCAAACCTTCATTGTCCCTGAATTCCATCAGTGGTGGTTGGTGTGACTCAGACCTCATGCCAATCCCTGAGTGTCTCCAAGACTAATGCCTTCATTATGTTCCAATTTTCCTTTGTCCTTGTGAACCCCCAAACCTGGATGGAAGGGAAGTGTAATCCCCATAGGAAAAGCCACGTTTTGTTTTCG
Full Trace Sequence: GGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGGGACATGCAGGCTCTTGGGGTTTAGTGGTTGCATTGGGGCTCTGTTCTTTGCTTTCTTGTGTTCAGGGATTTTGGGATGGATTACACTGTGGGCCCACAAACATGCAGTTTTCAGTCCCTTCGCTTGTACAAGATGTTGCTTTTGTGCTGTCAGCTGTGGATCACACTGGAAAATCTCACTACCTTGCCAATAACACTGCTTGTGGTACCTGGGTAGGACAGAAATCAGATGGTTCGCTGGTGGTTGATGCTGCCTACGATGGGTGCTTTGTTCATGAGGAGAATGGTGACCATGTGATGACGGTTAGTCTTGAAGAGGTAATAAATGGACATGTTGACTACCATAAACAAGAACTCAAGTGCCCAGTCATGGAAGCTATGGATGTTCCCAGCCCAGATACATGTTCTGCCATCAAGAGAGAAGACAGGCTTTCATGTGCCAAGGCTCCTGTATCACAAGACCTCTGTCAAGGGTTGGGTTGCTGTTACACATCCAGTGATCCTACAATGCCTTGTTACTATGGGAATAAATTGACTGCCCAGTGCTCGACCGACAACAATATGATGGTTGCCATTTCAAAAGATCTGACCAAACCTTCATTGTCCCTGAATTCCATCAGTGGTGGTTGGTGTGACTCAGACCTCATGCCAATCCCTGAGTGTCTCCAAGACTAATGCCTTCATTATGTTCCAATTTTCCTTTGTCCTTGTGAACCCCCAAACCTGGATGGAAGGGAAGTGTAATCCCCATAGGAAAAGCCACGTTTTGTTTTCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGGGACATGCAGGCTCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837538
dbEST ID: 79655240
Trimmed Sequence: AGCATTTACATCATGAGTCTTTGGGCTCCTATTCCTATAGTGTATCCAGAGACCAATAAAAGTTACAGTAACAGTCAAGACACCTCCTATGGCTGCTGCTCCTCTTGCCCATTGCAATACTGGATAACCAAAGCCGACAACGCCTTCTGTTTCTGTACGCTTTTCTTCTCCATCAATGAAGTCAACGGGTCCATCAGAGGTCACAGTGGTCTCCAGAGGATATACTGCAGGGCTCTCTTCAGCCATTCTTCTTTTTCTTGTGTTGCACACAATCCTGCACGTGTCAGCAGCAGATGGGATACACACAGAAGCACTACAGTGAAAGTAAACCATGCCACCAAGAGGAAGCTGTGTAGTTCCATCCACAAATGTAAAAGTGCTAATTGAGAAGCGTTGATAATGAGATGGGAAAGGTACAGCTTGGGTAGCAGCACCAACAGGAATCATCTGTGTGATATAGTTGTCTCCAGGGAAGGGGCATCTACTTGTCAAGACAGGCCATTGCGGCTGTGCAGTAGAGTCAGTGGAGGGTGTAGCCCAGCAATTGTTTAACACAAGCACCAGGTTTGGGTCCAGCCGCCTTAGTACTCTAACCTCCAAATAAACAGGATCTCTGAGTATCTTGATGACTGGGTAGTCTCCATCACCATAATAAATATTATACTGCATGGTCAGAGCAATTCTCATCTCCCAGCATAAAAAGCCCCAGGGGTTAAAAAATAGGAAAGCCGGTGGGCGGAAAGAAGTGTAAAACTTCAAAC
Full Trace Sequence: GAGGAAACTGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCATTTACATCATGAGTCTTTGGGCTCCTATTCCTATAGTGTATCCAGAGACCAATAAAAGTTACAGTAACAGTCAAGACACCTCCTATGGCTGCTGCTCCTCTTGCCCATTGCAATACTGGATAACCAAAGCCGACAACGCCTTCTGTTTCTGTACGCTTTTCTTCTCCATCAATGAAGTCAACGGGTCCATCAGAGGTCACAGTGGTCTCCAGAGGATATACTGCAGGGCTCTCTTCAGCCATTCTTCTTTTTCTTGTGTTGCACACAATCCTGCACGTGTCAGCAGCAGATGGGATACACACAGAAGCACTACAGTGAAAGTAAACCATGCCACCAAGAGGAAGCTGTGTAGTTCCATCCACAAATGTAAAAGTGCTAATTGAGAAGCGTTGATAATGAGATGGGAAAGGTACAGCTTGGGTAGCAGCACCAACAGGAATCATCTGTGTGATATAGTTGTCTCCAGGGAAGGGGCATCTACTTGTCAAGACAGGCCATTGCGGCTGTGCAGTAGAGTCAGTGGAGGGTGTAGCCCAGCAATTGTTTAACACAAGCACCAGGTTTGGGTCCAGCCGCCTTAGTACTCTAACCTCCAAATAAACAGGATCTCTGAGTATCTTGATGACTGGGTAGTCTCCATCACCATAATAAATATTATACTGCATGGTCAGAGCAATTCTCATCTCCCAGCATAAAAAGCCCCAGGGGTTAAAAAATAGGAAAGCCGGTGGGCGGAAAGAAGTGTAAAACTTCAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCATTTACATCATGAGTCTTTGG