Plasmid > CS10R-JW2252

CS10R-JW2252

Xenbase Number: n/a
Previous Plasmid name:
Species: Xla;Xtr
Gene symbol: Vector
Gene Name:
Gene synonyms:
Gene Function: vector only
Vector: pCS10R
Antibiotic: Amp
Purpose: Vector
Special Features: Vector for cloning of GFP-fusions. New vector~! This vector was designed to allow easy shuttling of GFP fusion clones from Clontech eGFP vectors into a CS-family Xenopus expression vector. The origin of this vector is pCS107.The MCS between BamHI and EcoRI is modified. ------------------------------------------------------------------------SP6 promoterSmaI, SacI and XbaI, SpeI, BamHI, EcoRV, PstI, EcoRI, SalI, NotI, StuI, XhoI T7 promoterCS10R-Sp6 (multi-cloning site : 28(smaI)-112(XhoI)GGAACTGCTCTTTTGAGGATCTTCCCCCGGGGGAGCTCTAGAGCACTAGTCGGGATCCCGGATATCTGCAGAATTCGTCGACAGGCCAATCTGGCCGCGGCCGCAAGGCCTCTCGAGCCTCTCGCCCTATAGTGAGTCGTATTA
Expression pattern:
Insert size and sites:
Antisense Linearization:
Antisense Polymerase:
Antisense size:
Sense Linearization:
Sense Polymerase:
Sense size:
Reference:
Comments:
Sequence: