ORFeome > eno1 – XORFeome 2.0

eno1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis enolase 1, (alpha), mRNA (cDNA clone MGC:75746 IMAGE:5381403), complete cds
Gene Symbol: eno1
Gene ID: 394749
ORF gb_acc: MG132949
ORF ID: 10323

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061287

Library Location

Plate ID: GDExt11003
Well Location: D08

EST Sequences

Clone: MGC:75746 IMAGE:5381403
Trimmed Sequence: ATGTCTATCAAGAAGATCCTTGCACGTGAAATTTTTGACTCTCGTGGTAACCCAACAGTGGAGGTTGACCTGTACACATGCAAAGGTCTCTTCCGTGCTGCTGTTCCAAGCGGAGCCTCCACTGGCATTTATGAAGCACTAGAACTCCGGGACAATGATAAGACTCGCTACATGGGAAAGGGTGTCGGAAGAGCTGTCAAATATATAAATGAGTTTCTGGGACCTGCATTATGCACCCAGAATCTAAGTGTTGTGGAGCAGGAAAAGATCGACAACCTCATGATTGAAATGGATGGGACTGAGAATAAATCCAAATTTGGTGCTAATGCACTCTTGGGAGTGTCCCTAGCAGTGTGTAAAGCTGGAGCTGCAGAGAAAGGAGTCCCACTGTACCGTCATATCGCTGACCTGGCTGGGAACCCAGAGGTCATCCTTCCTGTACCGGCATTTAATGTGATAAACGGGGGTTCTCATGCTGGAAACAAGCTGGCTATGCAAGAATTCATGATCTTGCCTGTGGGTGCAGACACCTTTAAGGAGGCCATGCGCATAGGAGCAGAGGTGTATCATAACCTAAAGAATGTCATCAAGGCTAAATATGGACAAGATGCCACTAATGTTGGTGATGAAGGAGGCTTTGCTCCCAATATCTTGGAGAATAAGGAAGCCCTGGAGCTTCTGAAAACTGCCATCAACAAGGCTGGCTACCCAGATAAAGTTGTAATTGGAATGGATGTTGCAGCATCTGAATTCTACCGTGACGGGAAATATGACTTGGACTTCAAGTCCCCTGATGACCCTAAAAGACACATCTCCCCTGACGAGCTGGCTGAGTTGTACATGAGCTTTGTCAAGAATTATCCAGTGGTGTCCATTGAAGATCCCTTTGATCAGGATGACTGGGAAGCCTGGAAAAAGTTTACTGCATCTTCGAATATCCAGGTAGTTGGTGATGACTTGACAGTGACCAACCCTAAACGTATTGCCAAGGCTGTGGATGAGAAGTCTTGTAACTGTCTGCTTCTGAAGGTCAACCAGATCGGCACAGTGACAGAATCCCTGCAGGCGTGCAAGCTGGCTCAGTCAAATGGCTGGGGTGTGATGGTCAGTCATCGCTCTGGGGAGACAGAAGATACTTTCATTGCTGACCTGGTGGTTGGTCTCCGCACTGGACAGATCAAGACAGGTGCTCCATGCAGATCTGAGCGACTTGCAAAATACAACCAATTGCTCAGGATTGAAGAAGAGCTTGGCAGCAAGGCCCGCTTTGCTGGAAGAAATTTCAGAAAACCTGTTTTCAACTAA
Full Trace Sequence: ggaagagaacggttgtacctacaagtagaaagtaaaaatgtctatcaagaagatccttgcacgtgaaatttttgactctcgtggtaacccaacagtggaggttgacctgtacacatgcaaaggtctcttccgtgctgctgttccaagcggagcctccactggcatttatgaagcactagaactccgggacaatgataagactcgctacatgggaaagggtgtcggaagagctgtcaaatatataaatgagtttctgggacctgcattatgcacccagaatctaagtgttgtggagcaggaaaagatcgacaacctcatgattgaaatggatgggactgagaataaatccaaatttggtgctaatgcactcttgggagtgtccctagcagtgtgtaaagctggagctgcagagaaaggagtcccactgtaccgtcatatcgctgacctggctgggaacccagaggtcatccttcctgtaccggcatttaatgtgataaacgggggttctcatgctggaaacaagctggctatgcaagaattcatgatcttgcctgtgggtgcagacacctttaaggaggccatgcgcataggagcagaggtgtatcataacctaaagaatgtcatcaaggctaaatatggacaagatgccactaatgttggtgatgaaggaggctttgctcccaatatcttggagaataaggaagccctggagcttctgaaaactgccatcaacaaggctggctacccagataaagttgtaattggaatggatgttgcagcatctgaattctaccgtgacgggaaatatgacttggacttcaagtcccctgatgaccctaaaagacacatctcccctgacgagctggctgagttgtacatgagctttgtcaagaattatccagtggtgtccattgaagatccctttgatcaggatgactgggaagcctggaaaaagtttactgcatcttcgaatatccaggtagttggtgatgacttgacagtgaccaaccctaaacgtattgccaaggctgtggatgagaagtcttgtaactgtctgcttctgaaggtcaaccagatcggcacagtgacagaatccctgcaggcgtgcaagctggctcagtcaaatggctggggtgtgatggtcagtcatcgctctggggagacagaagatactttcattgctgacctggtggttggtctccgcactggacagatcaagacaggtgctccatgcagatctgagcgacttgcaaaatacaaccaattgctcaggattgaagaagagcttggcagcaaggcccgctttgctggaagaaatttcagaaaacctgttttcaactaaatggaggcatccttaggctctcacccaactgatgtagtagctgtgcacctaggagagactacaggaggtcttacatgtcactgctgagccctcatttaatttcaggcacttccagcaatgttagatgttacagcctctcccagcataaccttgctgtctttccagtttaaaagctttgctgcttaggattattccaaattcagtgtcacactggtgcctgcatgtagtccttgtcttttctattgtggcagtggtcctggtcatgtcaactttgtagtcttgtgttctcatcctattgcagtttcagactagataatggtttgtcacactctagacacgaagaggcaataaactcttttgaaggtgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSIKKILAREIFDSRGNPTVEVDLYTCKGLFRAAVPSGASTGIYEALELRDNDKTRYMGKGVGRAVKYINEFLGPALCTQNLSVVEQEKIDNLMIEMDGTENKSKFGANALLGVSLAVCKAGAAEKGVPLYRHIADLAGNPEVILPVPAFNVINGGSHAGNKLAMQEFMILPVGADTFKEAMRIGAEVYHNLKNVIKAKYGQDATNVGDEGGFAPNILENKEALELLKTAINKAGYPDKVVIGMDVAASEFYRDGKYDLDFKSPDDPKRHISPDELAELYMSFVKNYPVVSIEDPFDQDDWEAWKKFTASSNIQVVGDDLTVTNPKRIAKAVDEKSCNCLLLKVNQIGTVTESLQACKLAQSNGWGVMVSHRSGETEDTFIADLVVGLRTGQIKTGAPCRSERLAKYNQLLRIEEELGSKARFAGRNFRKPVFN
Donor tissue: tadpole