ORFeome > gpx3 – XORFeome 2.0

gpx3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis glutathione peroxidase 3, mRNA (cDNA clone MGC:75694 IMAGE:5380394), complete cds
Gene Symbol: gpx3
Gene ID: 394558
ORF gb_acc: MG132889
ORF ID: 10253

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061262

Library Location

Plate ID: GDExt11002
Well Location: B11

EST Sequences

Clone: MGC:75694 IMAGE:5380394
Trimmed Sequence: ATGCAGTACCAAGAATTGAATGCACTACAAGAAGAATTAAAAAACAATAACTTTGTCATTTTGGGATTTCCTTCTAATCAGTTCGGGATGCAGGAGCCTGGAAGGAATGATGAAATTCTTTTGGGACTTGAGTATGTGCGTCCCGGGGGAAAATTCGTTCCAAACTTCCAATTATTTGAGAAGGGAGATATTAATGGACGAAAAGAACAGAAATTCTACACTTTTCTCAAGAACTCCTGCCCCCCTGTTGGTGACAACTTTGGAAGTGCAACAAATAGACTCATGTGGGAACCCATAAAGGTCAACGACGTCAAGTGGAACTTTGAGAAGTTTCTTGTGGGACCAGACGGCCGCCCAGTGAAACGCTGGCTCCCCCGCACACCTGTCGCCCAAGTGAGAAGAGAGATCATGTCCTACATGAAGTTACAGCCGGGAACACAAAGACTTCTTATGCTTGGATTGGAGCAAAAATAA
Full Trace Sequence: gagagctgattcctgtacctcccaaagatgggggtcaaacttagggggctattaatgctcccatgcttcctggctgctctcatccatgcacaaaatgaaatggatcagaaatcggtggattgctacagctccatcgatgggaccatctatgattatggggccactacattagacgggactcagttcatccctttcaaagcgtaccaagggaagtacatcctgtttgtgaatgtggccacatactgaggtctcaccatgcagtaccaagaattgaatgcactacaagaagaattaaaaaacaataactttgtcattttgggatttccttctaatcagttcgggatgcaggagcctggaaggaatgatgaaattcttttgggacttgagtatgtgcgtcccgggggaaaattcgttccaaacttccaattatttgagaagggagatattaatggacgaaaagaacagaaattctacacttttctcaagaactcctgcccccctgttggtgacaactttggaagtgcaacaaatagactcatgtgggaacccataaaggtcaacgacgtcaagtggaactttgagaagtttcttgtgggaccagacggccgcccagtgaaacgctggctcccccgcacacctgtcgcccaagtgagaagagagatcatgtcctacatgaagttacagccgggaacacaaagacttcttatgcttggattggagcaaaaataaaaccattgcagttgtgtccatgttgttcaatccatgattgtatgtttgctgtgatcatctatgtgtttgagtggtcagttggagatctgagggaatctataagctatctgtatgaaggccaagtcaaaaagcactcatgtgtgggacttgtctggaaaccagtgctggggcagatgctacttagtgcattcaggcatctgtgccagactgggataggcttcatagtgttacccttagcttccaacttacctcttgagcactagaatagaatgtaatgtgtgccaatattcaataaataatatttgtttgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MQYQELNALQEELKNNNFVILGFPSNQFGMQEPGRNDEILLGLEYVRPGGKFVPNFQLFEKGDINGRKEQKFYTFLKNSCPPVGDNFGSATNRLMWEPIKVNDVKWNFEKFLVGPDGRPVKRWLPRTPVAQVRREIMSYMKLQPGTQRLLMLGLEQK
Donor tissue: tadpole