ORFeome > irf2 – XORFeome 2.0

irf2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis interferon regulatory factor 2, mRNA (cDNA clone MGC:79503 IMAGE:6977055), complete cds
Gene Symbol: irf2
Gene ID: 493376
ORF gb_acc: MG133558
ORF ID: 11089

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080892

Library Location

Plate ID: GDExt11010
Well Location: C05

EST Sequences

Clone: MGC:79503 IMAGE:6977055
Trimmed Sequence: ATGCCAGTAGAAAGGATGCGAATGCGACCTTGGCTAGAAGAACAAATAAATAAAGATCTAATTCCTGGTTTAAAATGGTTAAATAAGGAGAAAAAGATATTTCAGATTCCATGGATGCATGCTGCTCGTCATGGCTGGGATGTTGATAAGGATGCTCCTTTATTCAGAAACTGGGCTATACACACAGGGAAGTATCAACCTGGAATAGACAAGCCAGACCCAAAGACATGGAAAGCAAACTTTCGCTGTGCTATGAACTCTTTACCAGACATTGAAGAAGTTAAGGATAAAAGTATGAAAAAAGGAAATAATGCTTTCAGGGTGTACAGGATGATCCCAGTAGCAGAAAGGCCATCAAAAAGAGGTAAAAAAAACAAAGCAGATAAAGAAGACAAAATCAAACTGGAACAGGAAGAAGCTACTGAAGCACCAGCACCTTCAATGAATGGATCATCTCTGGGACCCCTACCATATGCCATTTATAACCAACCAATAAAAGCTGAAGTTGATAGCACTGTGAATATTTTAGTTGTGGAGCATCCTATGTATAACACTGGTATAGTAGAAGAGATGATTGTCGCCAATCCTCCTGATGTCTGCCAAGTTGTAGAGGTAACTACAGAAAGTGAAGAACAGCCATCCGTAAGAACGCAACTGTACCCTTTGCAGATCTCCCCTGTGTCTTCATTTGCTGAAAGTGAAACAGACAGCGTGCCTAGCGATGATGAACGGATGAGCCATCGACGCCAGCAGAAGATCCCTGGCAGCAAAGAATCTGTAAGAACGTCAAGCCAAAGAGCCCCTTATAATTTACCTGGCATGGCAACATTTGTAACCTCCAAACCAGACCTGCAGGTCACTATAAAAGAGGAGAAGTATCCCCTTCCCTACAACAGCTCGTGGCCTATATTCCCAGACAGTACACCTTATTCACAGACGGGTGCATCCTCTTCACTAAATAGCGCTCGACAAGACCATGAAACTAGAGCTACTGTCATTAAGAAAACCTCAGATGTTGCTCAGCCAAGGCTGAAAACTTGCTAA
Full Trace Sequence: ccttgttttgctttcgatctggagccgtcacttttagttttgatcctgcgatcatttagtgctgttgcattcttgtcatcttggaacaatgccagtagaaaggatgcgaatgcgaccttggctagaagaacaaataaataaagatctaattcctggtttaaaatggttaaataaggagaaaaagatatttcagattccatggatgcatgctgctcgtcatggctgggatgttgataaggatgctcctttattcagaaactgggctatacacacagggaagtatcaacctggaatagacaagccagacccaaagacatggaaagcaaactttcgctgtgctatgaactctttaccagacattgaagaagttaaggataaaagtatgaaaaaaggaaataatgctttcagggtgtacaggatgatcccagtagcagaaaggccatcaaaaagaggtaaaaaaaacaaagcagataaagaagacaaaatcaaactggaacaggaagaagctactgaagcaccagcaccttcaatgaatggatcatctctgggacccctaccatatgccatttataaccaaccaataaaagctgaagttgatagcactgtgaatattttagttgtggagcatcctatgtataacactggtatagtagaagagatgattgtcgccaatcctcctgatgtctgccaagttgtagaggtaactacagaaagtgaagaacagccatccgtaagaacgcaactgtaccctttgcagatctcccctgtgtcttcatttgctgaaagtgaaacagacagcgtgcctagcgatgatgaacggatgagccatcgacgccagcagaagatccctggcagcaaagaatctgtaagaacgtcaagccaaagagccccttataatttacctggcatggcaacatttgtaacctccaaaccagacctgcaggtcactataaaagaggagaagtatccccttccctacaacagctcgtggcctatattcccagacagtacaccttattcacagacgggtgcatcctcttcactaaatagcgctcgacaagaccatgaaactagagctactgtcattaagaaaacctcagatgttgctcagccaaggctgaaaacttgctaaggccacgttgcaaatttgtatcaatatataggatgggaacaaatattgtggaaaacgttggatttgatgtggttggagcctttaagatgttggagaaccaaaggaaaggattcaatattcaagcatagctatggacagctcattgtagcagaggatttatctcaggattgggccatggaacggtctaagagattctaaaaagaaaataaatgattaaagctggaccaacttccattatggggaaggtcaaggctgaggaaatgcaacaaggcctttggacaaataaaatgtgaaactgctagaacattatccttttttattttaagaaaatctgtgctgtaaatatgtatattttatacgtgagttctagcaatctgcttgtgcacctcacaaacaagcactggcacaacaaggcggccttcttttgtactgctgtaaatggaattcaggccgaacccagctacccctgtcctttcgctcaaaacatgaatttcactgaaagtggttaaactgaaactctggcttttgcacctctgactgaaatgatgaattaataagtaacctttattaataacagggctttgtattctaaccttgcttcgctcacaaccaaggtacaaataggaatttctatcagccccaagacttgagagttaatataaatagaattatgcagacatataatgaccagactataactattaactcccagagctagcttttttatttttttatacgggggtattttatttgaggcaaaaatccaaagttaacataattattttctattttttttatacagcaaatttattatatgattcagtttcctgtttgtcagcaaaactgttgtggcacattttcgtaggtcttttgtttcctaacatgaaactgatatattaatctattatgtagaaagcaaatttattattattatcctgtggattgacaaataaatagtcattgcagttttatctgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPVERMRMRPWLEEQINKDLIPGLKWLNKEKKIFQIPWMHAARHGWDVDKDAPLFRNWAIHTGKYQPGIDKPDPKTWKANFRCAMNSLPDIEEVKDKSMKKGNNAFRVYRMIPVAERPSKRGKKNKADKEDKIKLEQEEATEAPAPSMNGSSLGPLPYAIYNQPIKAEVDSTVNILVVEHPMYNTGIVEEMIVANPPDVCQVVEVTTESEEQPSVRTQLYPLQISPVSSFAESETDSVPSDDERMSHRRQQKIPGSKESVRTSSQRAPYNLPGMATFVTSKPDLQVTIKEEKYPLPYNSSWPIFPDSTPYSQTGASSSLNSARQDHETRATVIKKTSDVAQPRLKTC
Donor tissue: tailbud