ORFeome > MGC75855 – XORFeome 2.0

MGC75855 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75855, mRNA (cDNA clone MGC:75855 IMAGE:5382752), complete cds
Gene Symbol: MGC75855
Gene ID: 407848
ORF gb_acc:
ORF ID: 11020

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC066783

Library Location

Plate ID: GDExt11009
Well Location: B09

EST Sequences

Clone: MGC:75855 IMAGE:5382752
Trimmed Sequence: ATGTCTCGGATTGAGTCCTTTGGCAAAGCCCCGGCGGAGCGCACCAAGAATAAAGAAAAAGAGAAGATGAAGGATTCCAAGGACCCCCGGTACACCAACGGGCACCTGTTCACCACCATCACCGTGTCTGGGACGACCATGTGCTTTGTGTGCAACAAGAGTATAACCGCTAAAGAGGCGCTGATTTGCCCCACCTGTAACGTTACCATACACAACCGCTGCAAAGATGCCCTGCCCAGCTGCACCAAGGTCAAACAGAAACAACAGAAAGCCGCTTTCCTGAAGAACAATTCTGCCCTGCAGAACGTCTCGCTGAGGAACAAAACCACGACGCTTCGAGAGCGCCCCAATTCGGCCATCTACCCCTCGGACAGCCTGCGCCACTCTATCCTGGGCTCCCGCCGGGGCCGGGCGTCTCTTTCTCTGTCTAAAAGTGTCTCCACCACCAACATTGCAGGGAACCTGAACGATGAGAGCCCACTGGGAATCCGCCGGATCCTCTCCCAATCTACCGACTCGCTCAATATGCGGAACCGGACTCTCTCCGTGGAGTCGCTCATCGATGAAGGCGCCGAGGTCGTGTACAGTCAGCTGATGAGCGACTTCGCCACCGAGGAGAAGGAATTCGAGGCGGATTCGTGGAGCCTGGCTGTGGATAACAACTACCTCCAGCAGCACAAGAAAGATGTCATGAAGCGGCAGGACGTGATATACGAGCTGATCCAGACGGAGGTCCACCACGTGCGCACCCTGAAGATCATGACCAACATATTCCGCAAGGGGATGCTGGAGGATCTGCAGATGGACCCGGCGCTGGTCAATAAGATGTTCCCCTGCGTGGACGAACTGAGCGACATTCACATCCGATTCCTCATTCAGCTCCTGGAGAGGCGCAAAGACTCGCTGGCGTCCGACAGCAACAAGAACTTTGTCATCAACAAGCTGGGGGATATCCTCATTAACCAGTTTTCAGGCACCAATGCCGAGCGGATGAAGAAAGCCTACACGGAATTCGCCAGCCAGCACCATAAGGCCATGAAGCTGTACAAGGAGCTCTTCTCCCGGGATAAGAAGTTCCAGCAGATGATACGGAAAATGACCCGCTCCCCCCTGCTGCGCAGGCACGGCGTCCAGGAATGCATCCTGCTAGTCACCCAGCGCATCACCAAGTACCCCGTGCTCCTTGACCGCATTCTGCAGAACTCTAAGGGCGATGAGGAGGAGTACCTAGACCTGGCCGAATCCTTGCGGATGGTGAAGGAGCTGATTACGACGATTGACCAAGACGTGCACAACCTGGAGAAGAGCTTACGCTTGCAGGAGATCTACCAGCGAATAGACAGCAAGTCTGTGGCACTAGTAGATGGGGACCACAGCTTTAGCAAGGAGGAGCTGCTGCGCCGGAAACTCATCCACGAGGGGTCGCTACTGTGGAAAACGGCTGCTGGGCGCTTCAAAGATGTGATTATGCTGCTAATGACAGACACCATGATTCTGCTTCAGGAGAAAGACCAGAAATATTATTTCCCAACGCTGGATAGATCTCCCGTCATCAGCCTGCAGAACCTGATAGTGCGGGACATTGCCAACCAGGAGAAGGGCATGTTCCTAATCAGCGCCAAGCCCCCCGAGATGTACGAGGTACACGCCGCCTCCCGCGAGGAGCGCAACACGTGGATGAAGCACATCGGCCAGTCGGTCAAAGTGTGCCCAAAGCGAGAGGAATTCCCGCTGATCGAGACAGAAGTGGAGGCGAAACTACGGAAGCTGAGAGAGGTGATTCAGCAGAAGGACCGGGAGGTGTCGGAGCTCCTGGAGGAGAAGGTGACGCTCTTTTCCAAAGTGGTGCAGCTCCAGGCGGGGGAGAATTCCCAGGGGCCCGGCATCGGCGCCCCCCGCTGCCTCTTTCGAACCGACTCCACCGACACCTACAGGGGCGAGAAGCTGATCGGCGACACCATCAAAGAAGTGGAAGCACTGAAAGACGTGATCATTGGGGCTGGCAGCGAACTGCCTCTTCTACGGACGGAACAGAACCACCCATTGGACACTTCCAACAGCCAATCCAGAGATTCCACATATGGGGACACAAACGCCGTCAATGGCTCCTGCGATGTTGCCAAGGAGGACGATCCAAAGGACCGGAACGGAAATCAGCTCCAAAACAAAAGCCCTCGTGAGGACGCCCTACAGAGGATTGTCAATATCTACAGCTTTCTACATGGGCTGCAGGCGATGGTCATACAACAGGACACGCTACAAGACGCGCCGCTCCAGGACGTCGGCGACAAGAAGGAGCGCCTGTGCCGGACCAACTCCCGCGATCCGATTCTGATAGAACCCAAGAGCGCAGACAAACAGACGGAGCTGACTCTGCTGCAGCGCCAACACACTCTGTTGCAGGAGGAGCTGCGCCGGTGCAAGCGGCAGTGCGACGACAGGGCGCAGGAGGCGGGGCTACTGGAGACCCGGCTGAGGGAGAGCGAGCAGATCCGGGGGAGGATGGAGCGGGAGTTGGAGGATGGGAAAAGGCAGCTGCTCCTCCTGAGAGAGAGAAACGACGCGGGGCTGGAGGGGGCCAGGAATCACAAAGTGTTGGATCCTCGTAGGCGGAGCTTGCCCGCGGGGGACGCCCTGTATCAGACCTTCACTCCGCCCCCGGTTCACGTGGAGAGGAGGGTCCCGCTGGTTCTGGACGGCCCGGTCCCCATCATTACTCTGCAGGACGACTCGGACCTCAAAGACGACTTCAGCGATCTCACCGAGCTGGAGAAACTGCCGGCCATGGCGGAAACGGAATGGACGGAGGAGGAGGGCGGGGGGCCCCCAGCTTCTCCCTCCAGCGCACGAGAATTCCAGAGAATGCAGGACATTCCAGAAGAGGCAGAGAGCGTTCAGGAGCTGAGAGACGCGGAGCAGGGATCCTCCGAGAGCTAA
Full Trace Sequence: ggcagattgtgagctccgtctccccgggaatagcagctccgtctccccaggaatagcagccagcactctctctctaacccccccaaactggattaaaccaaggcccggaggggggtcagccgcagggaccaccctgagcagaatatgtctcggattgagtcctttggcaaagccccggcggagcgcaccaagaataaagaaaaagagaagatgaaggattccaaggacccccggtacaccaacgggcacctgttcaccaccatcaccgtgtctgggacgaccatgtgctttgtgtgcaacaagagtataaccgctaaagaggcgctgatttgccccacctgtaacgttaccatacacaaccgctgcaaagatgccctgcccagctgcaccaaggtcaaacagaaacaacagaaagccgctttcctgaagaacaattctgccctgcagaacgtctcgctgaggaacaaaaccacgacgcttcgagagcgccccaattcggccatctacccctcggacagcctgcgccactctatcctgggctcccgccggggccgggcgtctctttctctgtctaaaagtgtctccaccaccaacattgcagggaacctgaacgatgagagcccactgggaatccgccggatcctctcccaatctaccgactcgctcaatatgcggaaccggactctctccgtggagtcgctcatcgatgaaggcgccgaggtcgtgtacagtcagctgatgagcgacttcgccaccgaggagaaggaattcgaggcggattcgtggagcctggctgtggataacaactacctccagcagcacaagaaagatgtcatgaagcggcaggacgtgatatacgagctgatccagacggaggtccaccacgtgcgcaccctgaagatcatgaccaacatattccgcaaggggatgctggaggatctgcagatggacccggcgctggtcaataagatgttcccctgcgtggacgaactgagcgacattcacatccgattcctcattcagctcctggagaggcgcaaagactcgctggcgtccgacagcaacaagaactttgtcatcaacaagctgggggatatcctcattaaccagttttcaggcaccaatgccgagcggatgaagaaagcctacacggaattcgccagccagcaccataaggccatgaagctgtacaaggagctcttctcccgggataagaagttccagcagatgatacggaaaatgacccgctcccccctgctgcgcaggcacggcgtccaggaatgcatcctgctagtcacccagcgcatcaccaagtaccccgtgctccttgaccgcattctgcagaactctaagggcgatgaggaggagtacctagacctggccgaatccttgcggatggtgaaggagctgattacgacgattgaccaagacgtgcacaacctggagaagagcttacgcttgcaggagatctaccagcgaatagacagcaagtctgtggcactagtagatggggaccacagctttagcaaggaggagctgctgcgccggaaactcatccacgaggggtcgctactgtggaaaacggctgctgggcgcttcaaagatgtgattatgctgctaatgacagacaccatgattctgcttcaggagaaagaccagaaatattatttcccaacgctggatagatctcccgtcatcagcctgcagaacctgatagtgcgggacattgccaaccaggagaagggcatgttcctaatcagcgccaagccccccgagatgtacgaggtacacgccgcctcccgcgaggagcgcaacacgtggatgaagcacatcggccagtcggtcaaagtgtgcccaaagcgagaggaattcccgctgatcgagacagaagtggaggcgaaactacggaagctgagagaggtgattcagcagaaggaccgggaggtgtcggagctcctggaggagaaggtgacgctcttttccaaagtggtgcagctccaggcgggggagaattcccaggggcccggcatcggcgccccccgctgcctctttcgaaccgactccaccgacacctacaggggcgagaagctgatcggcgacaccatcaaagaagtggaagcactgaaagacgtgatcattggggctggcagcgaactgcctcttctacggacggaacagaaccacccattggacacttccaacagccaatccagagattccacatatggggacacaaacgccgtcaatggctcctgcgatgttgccaaggaggacgatccaaaggaccggaacggaaatcagctccaaaacaaaagccctcgtgaggacgccctacagaggattgtcaatatctacagctttctacatgggctgcaggcgatggtcatacaacaggacacgctacaagacgcgccgctccaggacgtcggcgacaagaaggagcgcctgtgccggaccaactcccgcgatccgattctgatagaacccaagagcgcagacaaacagacggagctgactctgctgcagcgccaacacactctgttgcaggaggagctgcgccggtgcaagcggcagtgcgacgacagggcgcaggaggcggggctactggagacccggctgagggagagcgagcagatccgggggaggatggagcgggagttggaggatgggaaaaggcagctgctcctcctgagagagagaaacgacgcggggctggagggggccaggaatcacaaagtgttggatcctcgtaggcggagcttgcccgcgggggacgccctgtatcagaccttcactccgcccccggttcacgtggagaggagggtcccgctggttctggacggcccggtccccatcattactctgcaggacgactcggacctcaaagacgacttcagcgatctcaccgagctggagaaactgccggccatggcggaaacggaatggacggaggaggagggcggggggcccccagcttctccctccagcgcacgagaattccagagaatgcaggacattccagaagaggcagagagcgttcaggagctgagagacgcggagcagggatcctccgagagctaaagagacagccccactacagacgcgagacggacggacgcgctgctctacgagagcccctcgggggagcagtgagaggaggggggaggcctttgctagtgacgcccctgtatccgacccgcgcggcgacttcccagcatccgaagggggcgccacctgcgaactggtccagccagggggattgtggggcagcgttttggcaccgcccccctcgccaaatcttccacactcttacacgaccggagcaggcagatctgccccacagagggttaaaaaacaacaaaaaaaaggactttttattaaatatcggactttttttttccaaaccttggtatacgaagacgcagtatcactacaatttatatggccgctgcaatcaatatggcggctccaaccccctcatacaccgcaggaccatggccccgcccccacaggctgccgattggccaccatggaaaggttgaaatttaggcttcgctttgcgcatctccatatccttcccccccccccccccaaaccgctctctcatgcccctcccccttatttatttatcattttaattaaaaagtaacatttttaagttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSRIESFGKAPAERTKNKEKEKMKDSKDPRYTNGHLFTTITVSGTTMCFVCNKSITAKEALICPTCNVTIHNRCKDALPSCTKVKQKQQKAAFLKNNSALQNVSLRNKTTTLRERPNSAIYPSDSLRHSILGSRRGRASLSLSKSVSTTNIAGNLNDESPLGIRRILSQSTDSLNMRNRTLSVESLIDEGAEVVYSQLMSDFATEEKEFEADSWSLAVDNNYLQQHKKDVMKRQDVIYELIQTEVHHVRTLKIMTNIFRKGMLEDLQMDPALVNKMFPCVDELSDIHIRFLIQLLERRKDSLASDSNKNFVINKLGDILINQFSGTNAERMKKAYTEFASQHHKAMKLYKELFSRDKKFQQMIRKMTRSPLLRRHGVQECILLVTQRITKYPVLLDRILQNSKGDEEEYLDLAESLRMVKELITTIDQDVHNLEKSLRLQEIYQRIDSKSVALVDGDHSFSKEELLRRKLIHEGSLLWKTAAGRFKDVIMLLMTDTMILLQEKDQKYYFPTLDRSPVISLQNLIVRDIANQEKGMFLISAKPPEMYEVHAASREERNTWMKHIGQSVKVCPKREEFPLIETEVEAKLRKLREVIQQKDREVSELLEEKVTLFSKVVQLQAGENSQGPGIGAPRCLFRTDSTDTYRGEKLIGDTIKEVEALKDVIIGAGSELPLLRTEQNHPLDTSNSQSRDSTYGDTNAVNGSCDVAKEDDPKDRNGNQLQNKSPREDALQRIVNIYSFLHGLQAMVIQQDTLQDAPLQDVGDKKERLCRTNSRDPILIEPKSADKQTELTLLQRQHTLLQEELRRCKRQCDDRAQEAGLLETRLRESEQIRGRMERELEDGKRQLLLLRERNDAGLEGARNHKVLDPRRRSLPAGDALYQTFTPPPVHVERRVPLVLDGPVPIITLQDDSDLKDDFSDLTELEKLPAMAETEWTEEEGGGPPASPSSAREFQRMQDIPEEAESVQELRDAEQGSSES
Donor tissue: neurula