ORFeome > twist1 – XORFeome 2.0

twist1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis twist homolog 1, mRNA (cDNA clone MGC:69439 IMAGE:5335836), complete cds
Gene Symbol: twist1
Gene ID: 395054
ORF gb_acc: MG133301
ORF ID: 10793

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074558

Library Location

Plate ID: GDExt11007
Well Location: D10

EST Sequences

Clone: MGC:69439 IMAGE:5335836
Trimmed Sequence: ATGATGCAGGAAGAGTCCAGCTCCCCAGTCTCCCCAGTAGACAGTCTAAGTAACAGCGAGGAAGAGCTTGACAGGCAGCACAGCAAGAGGGGATGCAGAAAGAAGCGATCCACTAGGAAAAGCCCTGAGGATCCCGACAGCCCCATCTCAGTGAAGCGCAACAAGAAGTCCAGCAGCACCGGCAGCAGCCCGCAATCCTTTGAAGAACTGCAAAGCCAGAGGGTCATGGCCAATGTCAGGGAGCGCCAGAGGACCCAGTCCCTAAATGAAGCCTTCGCAGCCCTGAGGAAGATCATCCCCACCCTCCCCTCTGACAAACTGAGTAAAATCCAGACTCTCAAACTGGCATCCAGATACATCGACTTTCTCTGCCAGGTCTTACAGAGCGACGAGCTGGACTCCAAAATGGCCAGCTGCAGTTATGTGGCCCATGAGAGGCTCAGCTATGCATTTTCAGTGTGGAGGATGGAGGGAGCATGGTCCATGTCTGCATCTCACTAA
Full Trace Sequence: gactgtgctatagggctgggcgcactccccccacccacccacccacctcagcaccttggagaagactttgctcgggagatctgttgggacagagcctgccctctgcccgggaccttctcctgattgtgctgggagaaaatgatgcaggaagagtccagctccccagtctccccagtagacagtctaagtaacagcgaggaagagcttgacaggcagcacagcaagaggggatgcagaaagaagcgatccactaggaaaagccctgaggatcccgacagccccatctcagtgaagcgcaacaagaagtccagcagcaccggcagcagcccgcaatcctttgaagaactgcaaagccagagggtcatggccaatgtcagggagcgccagaggacccagtccctaaatgaagccttcgcagccctgaggaagatcatccccaccctcccctctgacaaactgagtaaaatccagactctcaaactggcatccagatacatcgactttctctgccaggtcttacagagcgacgagctggactccaaaatggccagctgcagttatgtggcccatgagaggctcagctatgcattttcagtgtggaggatggagggagcatggtccatgtctgcatctcactaacaggaatgccactacagcacaggccacacagaaagacgatactttaaccaatgaatgggaaatggacagtgtagaaactggagctggatacccaaaacaattaaatctgaggatttttgtgcattagggtgaaagggccgaagcgaatgaaggcgtgcggagcacttacagagcaaatctgccctgggacactgaatttatacagcagggagccgtgtaggttcgccaaatccattccattctgatcctgaacaatctctcatctggactttgacgaagaatgttggaaattattttctttaattcgtttttccttgtactttttgtatactgcatgcatgcgttaccaccagtcgtgcctttgaagccactttagaggaaaatatttgaacattcccattcttgaaggtttctatcgaaatccatttttttaaataggaaggaaaaaaatactatttttgctatttgattcttggttcagaaaactgtttctatacaagcggcggcatctctttattcatcacctgagaaaaaaagttaacatttatttatttattgatccatgtttaaaaaaaaaaatgcaactagatccggtgtctaaatgcattcatattttttatggttgttttgtaaatatcattgtatattatttttctgcaataaataaatatgattgaaaaaaaaaaaaaaaaaaaaaaa
Translation: MMQEESSSPVSPVDSLSNSEEELDRQHSKRGCRKKRSTRKSPEDPDSPISVKRNKKSSSTGSSPQSFEELQSQRVMANVRERQRTQSLNEAFAALRKIIPTLPSDKLSKIQTLKLASRYIDFLCQVLQSDELDSKMASCSYVAHERLSYAFSVWRMEGAWSMSASH
Donor tissue: tailbud