ORFeome > abt1 ORF1 – XORFeome v1.0

abt1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: abt1
Gene ID: 5916383
Gene Page ID: 5916362
ORF Xenbase ID: 17262783

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC041500
Original XGC clone length: 717

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ823806
dbEST ID: 79641508
Trimmed Sequence: ATGGCAGATAAAGGGGAGAAAGGATCTTGCCAAGGGAAAAGAGTCGTTCCTGGAATTCTATATTTAGGTCACATTCCTCCTCGGCTCCGCCCACGGCACATTCGCAACATGCTGAGCCTCCATGGGGAAGTGGGGCGCATCTTCCTGCAGGCAGAGGAGCGATTTGTTCGTAAGAAAAAGAAGAAAGCGGGCAGCAATGCCAAAGACTTCACCGAGGGCTGGGTAGAGTTCCGGGACAAGCGTGTCGCCAAGCTGGTAGCTGCCAGTCTGAACAACGCACCCATGGGCACCCGCAAGAAGAACCGATTCCATGACGATCTGTGGAACATGAAGTACCTGCACCGTTTCAAGTGGTCTCACCTGAGCGAGCGGCTGGCCATAGAGCGGCAGGTGAGGCAGCAGCGCATGAGGGCGGAGGTGTCGCAAGCCAAGAGGGAGACCAACTTCTACCTGCAGAACGTGGAGCGGAGCAAGAGGTTCAGCAAAGCGGATCGCAAGAGTGCCGGGGATGCAGAGGGTGGCACTGCCAACAAGCAGTGGAACTTTACACAGCGCAGGACAGAGGACGAGATTCAGTGCATGAAGTCTGTGGGAAAAGCTGGAGACAAAGTGCGAATGCGAAAGAGATTGGAAGTGGCCGAGCGAGCGCANGAGAAATCTCAGACCAACCGCTCGCTGCTGCACAAGATATTTAACCCTACAGGGGGCACAGCATT
Full Trace Sequence: CAGATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGATAAAGGGGAGAAAGGATCTTGCCAAGGGAAAAGAGTCGTTCCTGGAATTCTATATTTAGGTCACATTCCTCCTCGGCTCCGCCCACGGCACATTCGCAACATGCTGAGCCTCCATGGGGAAGTGGGGCGCATCTTCCTGCAGGCAGAGGAGCGATTTGTTCGTAAGAAAAAGAAGAAAGCGGGCAGCAATGCCAAAGACTTCACCGAGGGCTGGGTAGAGTTCCGGGACAAGCGTGTCGCCAAGCTGGTAGCTGCCAGTCTGAACAACGCACCCATGGGCACCCGCAAGAAGAACCGATTCCATGACGATCTGTGGAACATGAAGTACCTGCACCGTTTCAAGTGGTCTCACCTGAGCGAGCGGCTGGCCATAGAGCGGCAGGTGAGGCAGCAGCGCATGAGGGCGGAGGTGTCGCAAGCCAAGAGGGAGACCAACTTCTACCTGCAGAACGTGGAGCGGAGCAAGAGGTTCAGCAAAGCGGATCGCAAGAGTGCCGGGGATGCAGAGGGTGGCACTGCCAACAAGCAGTGGAACTTTACACAGCGCAGGACAGAGGACGAGATTCAGTGCATGAAGTCTGTGGGAAAAGCTGGAGACAAAGTGCGAATGCGAAAGAGATTGGAAGTGGCCGAGCGAGCGCANGAGAAATCTCAGACCAACCGCTCGCTGCTGCACAAGATATTTAACCCTACAGGGGGCACAGCATTGCCCACTTTCTTGTACAAAGTGGGCATTATAAGAAAGCATTGGCTTATCAATTTGGTTGCACCGAAACAGGGTCACTAATCAGGTCAAAATAAAAAATCATTTTATTTTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGATAAAGGGGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829116
dbEST ID: 79646818
Trimmed Sequence: TGCTGTGCCCCCTGTAGGGTTAAATATCTTGTGCAGCAGCGAGCGGTTGGTCTGAGATTTCTCCTGCGCTCGCTCGGCCACTTCCAATCTCTTTCGCATTCGCACTTTGTCTCCAGCTTTTCCCACAGACTTCATGCACTGAATCTCGTCCTCTGTCCTGCGCTGTGTAAAGTTCCACTGCTTGTTGGCAGTGCCACCCTCTGCATCCCCGGCACTCTTGCGATCCGCTTTGCTGAACCTCTTGCTCCGCTCCACGTTCTGCAGGTAGAAGTTGGTCTCCCTCTTGGCTTGCGACACCTCCGCCCTCATGCGCTGCTGCCTCACCTGCCGCTCTATGGCCAGCCGCTCGCTCAGGTGAGACCACTTGAAACGGTGCAGGTACTTCATGTTCCACAGATCGTCATGGAATCGGTTCTTCTTGCGGGTGCCCATGGGTGCGTTGTTCAGACTGGCAGCTACCAGCTTGGCGACACGCTTGTCCCGGAACTCTACCCAGCCCTCGGTGAAGTCTTTGGCATTGCTGCCCGCTTTCTTCTTTTTCTTACGAACAAATCGCTCCTCTGCCTGCACGAAGATGCGCCCCACTTCCCCATGGAGGCTCAGCATGTTGCGAATGTGCCGTGGGCGGAGCCGAGGAAGGATGTGACCTAAATATAGAAATCCAGGAACGACTCTTTTTCCCTTGGCAGATGCTTTCATCCCTTAATCTGCCCTGGGGGCCCACTTTTTTTTTAAAAAGCTTGGAAGTTATAAAAAAAAAGATTTGTACA
Full Trace Sequence: TGCCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTGTGCCCCCTGTAGGGTTAAATATCTTGTGCAGCAGCGAGCGGTTGGTCTGAGATTTCTCCTGCGCTCGCTCGGCCACTTCCAATCTCTTTCGCATTCGCACTTTGTCTCCAGCTTTTCCCACAGACTTCATGCACTGAATCTCGTCCTCTGTCCTGCGCTGTGTAAAGTTCCACTGCTTGTTGGCAGTGCCACCCTCTGCATCCCCGGCACTCTTGCGATCCGCTTTGCTGAACCTCTTGCTCCGCTCCACGTTCTGCAGGTAGAAGTTGGTCTCCCTCTTGGCTTGCGACACCTCCGCCCTCATGCGCTGCTGCCTCACCTGCCGCTCTATGGCCAGCCGCTCGCTCAGGTGAGACCACTTGAAACGGTGCAGGTACTTCATGTTCCACAGATCGTCATGGAATCGGTTCTTCTTGCGGGTGCCCATGGGTGCGTTGTTCAGACTGGCAGCTACCAGCTTGGCGACACGCTTGTCCCGGAACTCTACCCAGCCCTCGGTGAAGTCTTTGGCATTGCTGCCCGCTTTCTTCTTTTTCTTACGAACAAATCGCTCCTCTGCCTGCACGAAGATGCGCCCCACTTCCCCATGGAGGCTCAGCATGTTGCGAATGTGCCGTGGGCGGAGCCGAGGAAGGATGTGACCTAAATATAGAAATCCAGGAACGACTCTTTTTCCCTTGGCAGATGCTTTCATCCCTTAATCTGCCCTGGGGGCCCACTTTTTTTTTAAAAAGCTTGGAAGTTATAAAAAAAAAGATTTGTACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTGTGCCCCCTGTAGGGT