ORFeome > afap1l2 ORF1 – XORFeome v1.0

afap1l2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: afap1l2
Gene ID: 6255187
Gene Page ID: 6460467
ORF Xenbase ID: 17263407

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057722
Original XGC clone length: 2436

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ824528
dbEST ID: 79642230
Trimmed Sequence: ATGGAAAGATATAAAGGACTGGAGCGGCTGCTGTCGGAGCTGGAGGAATTCTTGTTCATTCTGGATAAGGAAAATCTCAGCAGCGCCGCCGTCCTGAAGAAATCGATTGTGTCTGAGATCCTCCAGCTCTTTATAAAGAGTAACAGCAGCTGTGATGAGGAATACATCTATATGAACAAAGTGCTGGAGACAGACAAGAAGGAGGCTCAGGGGAAACAGGGGAAAGCCCAAGTGTTGGACCCCCCAGCCAAGGAGACGCTGACCAATGGGACGGCCGGACAGCATTTAGCACCCCCACAGAAAAGCCTCCCAGACCTGCCACCACCCAAAATAATTACAGAAAAGTTACCAGTCTCTAAATGTGACTCCCCAGAGGGTTACTACGAGGAGGCAGAGCCATACAACGCCTCCTTTAATGACGACGGGGAAGCCGTGAGCAGCTCGTATGAATCTTATGATGAAGACGAGAGTAACAAGAGCAAGAGCGCAATGCAGCAGCACCAATGGCCGTCCACCGAAGCCTCCATTGAGCTGATGAAAGATGCGATGATCTGCGCCTTCCTGTGGCGCAAGAAATGGCTCGGCCAATGGGCCAAACAGCTCTGCGTCGTTAAGGACACGCGGCTGATGTGCTATAAAACCTCCAAGGATCACAACCCGCAGCTGGACGTGAATCTGATTGGGCTGCAGTGTGTCGTACAAGGAGAAGCAGGTCAGGAGGAAGGAGCACAAGCTGAAAATCACTCCANCCCACCACCGACGTCATTTTTACTGGGGGATGCAAAGCCAAAGAACAAGGCGGAACCAGTGGGTTAAAGGGTAAAACCAA
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAAGATATAAAGGACTGGAGCGGCTGCTGTCGGAGCTGGAGGAATTCTTGTTCATTCTGGATAAGGAAAATCTCAGCAGCGCCGCCGTCCTGAAGAAATCGATTGTGTCTGAGATCCTCCAGCTCTTTATAAAGAGTAACAGCAGCTGTGATGAGGAATACATCTATATGAACAAAGTGCTGGAGACAGACAAGAAGGAGGCTCAGGGGAAACAGGGGAAAGCCCAAGTGTTGGACCCCCCAGCCAAGGAGACGCTGACCAATGGGACGGCCGGACAGCATTTAGCACCCCCACAGAAAAGCCTCCCAGACCTGCCACCACCCAAAATAATTACAGAAAAGTTACCAGTCTCTAAATGTGACTCCCCAGAGGGTTACTACGAGGAGGCAGAGCCATACAACGCCTCCTTTAATGACGACGGGGAAGCCGTGAGCAGCTCGTATGAATCTTATGATGAAGACGAGAGTAACAAGAGCAAGAGCGCAATGCAGCAGCACCAATGGCCGTCCACCGAAGCCTCCATTGAGCTGATGAAAGATGCGATGATCTGCGCCTTCCTGTGGCGCAAGAAATGGCTCGGCCAATGGGCCAAACAGCTCTGCGTCGTTAAGGACACGCGGCTGATGTGCTATAAAACCTCCAAGGATCACAACCCGCAGCTGGACGTGAATCTGATTGGGCTGCAGTGTGTCGTACAAGGAGAAGCAGGTCAGGAGGAAGGAGCACAAGCTGAAAATCACTCCANCCCACCACCGACGTCATTTTTACTGGGGGATGCAAAGCCAAAGAACAAGGCGGAACCAGTGGGTTAAAGGGTAAAACCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAGATATAAAGGACTGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829879
dbEST ID: 79647581
Trimmed Sequence: ACTTGCGCCTTTCTTCTCCCACTCCTTGGCCTTCTGCAAGACCTTTCCAGTGGTCACGATTGGCTGGGGTCTGCTTTTTAGGGCCACGGCTGAATTCACCGGGGAGCCAACGGTTGCTGTTACGGGGGAGCATTCTGGAGCATGTGTCGGACTGCAGGACTTTATACTTGGGGCAGTGGTGTCCAGGTGTGCAGGTTCTACACTGGTCCCTAATGTTGCCGGACCCAACTCGGCTTTCCTGAGATTCTCCTTCACCTCCACAAGTTTCAGCTCCAGGTCCACACGGTAACTCTCTCTCTCTTTACACTGCTCCTCTTTCAGTCTCAGTTTGTCCTCGAGGTCAGTCAGGAGACCTTTATCTGGACAGTTAGTGACCGTTTCCTTCATCTCCCGACGTTCCTTGCGTAGCTGCGCCAGCTGAACCCGGATCTCTTCTCTCTCTTTCTCCAACTTCTCCTTCTCTTCTGTGAAACGCTTTATCTCTGCCTCTGTCCGGTTCTTCCCCAGCAAAGTCTCTATGGCCACGTGATTAGTCGCCTTCACTCTCTCCTTGTTGCTCTTCTCCAGCCTGGGACTAGCACTCACTGACGGTCCTATTATCGGGGTACCGGGGGAAGTTTGCTGTGGGGGGTCTTCTGTGACCTGTTTAGTCTCCTCAGTCACCTGGCCCAAAAAAATCTTGTTCCCTGGCAGGAAAACGGTCCCTTCCCTCCCCT
Full Trace Sequence: CCGTGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTTGCGCCTTTCTTCTCCCACTCCTTGGCCTTCTGCAAGACCTTTCCAGTGGTCACGATTGGCTGGGGTCTGCTTTTTAGGGCCACGGCTGAATTCACCGGGGAGCCAACGGTTGCTGTTACGGGGGAGCATTCTGGAGCATGTGTCGGACTGCAGGACTTTATACTTGGGGCAGTGGTGTCCAGGTGTGCAGGTTCTACACTGGTCCCTAATGTTGCCGGACCCAACTCGGCTTTCCTGAGATTCTCCTTCACCTCCACAAGTTTCAGCTCCAGGTCCACACGGTAACTCTCTCTCTCTTTACACTGCTCCTCTTTCAGTCTCAGTTTGTCCTCGAGGTCAGTCAGGAGACCTTTATCTGGACAGTTAGTGACCGTTTCCTTCATCTCCCGACGTTCCTTGCGTAGCTGCGCCAGCTGAACCCGGATCTCTTCTCTCTCTTTCTCCAACTTCTCCTTCTCTTCTGTGAAACGCTTTATCTCTGCCTCTGTCCGGTTCTTCCCCAGCAAAGTCTCTATGGCCACGTGATTAGTCGCCTTCACTCTCTCCTTGTTGCTCTTCTCCAGCCTGGGACTAGCACTCACTGACGGTCCTATTATCGGGGTACCGGGGGAAGTTTGCTGTGGGGGGTCTTCTGTGACCTGTTTAGTCTCCTCAGTCACCTGGCCCAAAAAAATCTTGTTCCCTGGCAGGAAAACGGTCCCTTCCCTCCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTTGCGCCTTTCTTCTCCCACT