ORFeome > arfip1 ORF1 – XORFeome v1.0

arfip1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: arfip1
Gene ID: 951011
Gene Page ID: 951004
ORF Xenbase ID: 17264721

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045010
Original XGC clone length: 1029

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ824090
dbEST ID: 79641792
Trimmed Sequence: ATGGCTCAAGATTCACCTAGAAATGAAGTAGCTGAAATTACTGTGACCAGCAATGGAGAAGTTGATGACACATCAGAGCATAGTTTTAATTTGGACCTAAAGCGTTCAATATCAGCTGGACTTGGACTTTCCGAAACGCAGATCACTTCACATGGCATTGATAGCACCGCAGAAGGTATCGTTGAATCGGGGCCCTTTCAAGCTGAGCAGCAGAGGAAACAGCAGACGAGTGGCCCGGTTGTTCTTGCAGAGGAACCTAGAAGCACAGCTGTTGAAAAACTTGAGCTTGTTAGAAGATGGAGCCTTAACACATACAAGTGTACGCGCCAGATCCTCTCTGAGAAACTAGGTCGTGGCTCCAAAACAGTGGACCTGGAGCTGGAGTCCCAGATAGAAATCCTTCGAGATAACAAAAAGAAGTACGAGAATGTTCTGAAGCTGGCACAAACTCTCTCCACGCAGCTCTTCCAGATGGTACAGACCCAGAGGCAGTTGGGAGATGCTTTTGCTGACCTCAGCTTGAAGTCTCTAGAGCTCCATGAGGAGTTTGGATACAATGCAGATACGCAGAAACTTCTCGCCAAGAATGGGGAGACTCTCCTGGGGGCCATGAACTTTTTTATTTCTGGTGTCAACACTCTAGTTAACNAAACCATTGAAGACACCCTGATTACTGTGAAGCAGTATGAAGCATCCAGGATTGAGTATGATGCATATCGTACAGACCCTTGAGGAACTGACAATGGGGCCCCCTGGAGGCCTCCCCACTGCCCAAAAAATTAAAAATTCCCCCCCAACTTTTCCCAACCCCCCAAGGAAAAAATGAAAAAATGAGGGGAAGGAAGTGTTCTT
Full Trace Sequence: TAATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCAAGATTCACCTAGAAATGAAGTAGCTGAAATTACTGTGACCAGCAATGGAGAAGTTGATGACACATCAGAGCATAGTTTTAATTTGGACCTAAAGCGTTCAATATCAGCTGGACTTGGACTTTCCGAAACGCAGATCACTTCACATGGCATTGATAGCACCGCAGAAGGTATCGTTGAATCGGGGCCCTTTCAAGCTGAGCAGCAGAGGAAACAGCAGACGAGTGGCCCGGTTGTTCTTGCAGAGGAACCTAGAAGCACAGCTGTTGAAAAACTTGAGCTTGTTAGAAGATGGAGCCTTAACACATACAAGTGTACGCGCCAGATCCTCTCTGAGAAACTAGGTCGTGGCTCCAAAACAGTGGACCTGGAGCTGGAGTCCCAGATAGAAATCCTTCGAGATAACAAAAAGAAGTACGAGAATGTTCTGAAGCTGGCACAAACTCTCTCCACGCAGCTCTTCCAGATGGTACAGACCCAGAGGCAGTTGGGAGATGCTTTTGCTGACCTCAGCTTGAAGTCTCTAGAGCTCCATGAGGAGTTTGGATACAATGCAGATACGCAGAAACTTCTCGCCAAGAATGGGGAGACTCTCCTGGGGGCCATGAACTTTTTTATTTCTGGTGTCAACACTCTAGTTAACNAAACCATTGAAGACACCCTGATTACTGTGAAGCAGTATGAAGCATCCAGGATTGAGTATGATGCATATCGTACAGACCCTTGAGGAACTGACAATGGGGCCCCCTGGAGGCCTCCCCACTGCCCAAAAAATTAAAAATTCCCCCCCAACTTTTCCCAACCCCCCAAGGAAAAAATGAAAAAATGAGGGGAAGGAAGTGTTCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCAAGATTCACCTAGAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829398
dbEST ID: 79647100
Trimmed Sequence: CTGCTCTTCCAACCAGGATGGGGCATCCACGCCTGGGGTTTTCAATTTCACATGGAACTGTTTCAGCGTCTCTTCCAGCTGCTTCTGATTTCCGGCAAAATAGGCGGCTATTGCGTTGTGGAACAAGACAAGTTGATTGTGCAGTACTTTTACCTTGTTCTCCTCCAGAAACTTGAGTTTGACAGAAACATCATTCCGCATTTTGTCATACTTCTCCTTGTGGCTCTGGAAAAGCTGCTGCGACTGTTCAATCTTCGGCATTGTGATGGCATCACGTGGGCCCATGTTCAGTTCTTCAAGGTCTGTACGATATGCATCATACTCAATCCTGGATGCTTCATACTGCTTCACAGTAATCAGGGTGTCTTCAATGGTTTTGTTAACTAGAGTGTTGACACCAGAAATAAAAAAGTTCATGGCCCCCAGGAGAGTCTCCCCATTCTTGGCGAGAAGTTTCTGCGTATCTGCATTGTATCCGAACTCCTCATGGAGCTCTAGAGACTTCAAGCTGAGGTCAGCAAAAGCATCTCCCAACTGCCTCTGGGTCTGTACCATCTGGAAGAACTGCGTGGAGAGAGTTTGTGCCAGCTTCAGAACATTCTCGTAACTTCTTTTGTTATCTCCAAAGATTTCTAACTGGGACCTCGGCTCCCGGGTCACTGTTTTGGAACCACGACCTAGTTTCCTCAAAAAGAAATCGGGCCCGTAAACCTTTGAAGGGGTTTAAGGCTCCCTTCTTTCTAACAAACCTCCAATTTTTTT
Full Trace Sequence: ACGAGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGCTCTTCCAACCAGGATGGGGCATCCACGCCTGGGGTTTTCAATTTCACATGGAACTGTTTCAGCGTCTCTTCCAGCTGCTTCTGATTTCCGGCAAAATAGGCGGCTATTGCGTTGTGGAACAAGACAAGTTGATTGTGCAGTACTTTTACCTTGTTCTCCTCCAGAAACTTGAGTTTGACAGAAACATCATTCCGCATTTTGTCATACTTCTCCTTGTGGCTCTGGAAAAGCTGCTGCGACTGTTCAATCTTCGGCATTGTGATGGCATCACGTGGGCCCATGTTCAGTTCTTCAAGGTCTGTACGATATGCATCATACTCAATCCTGGATGCTTCATACTGCTTCACAGTAATCAGGGTGTCTTCAATGGTTTTGTTAACTAGAGTGTTGACACCAGAAATAAAAAAGTTCATGGCCCCCAGGAGAGTCTCCCCATTCTTGGCGAGAAGTTTCTGCGTATCTGCATTGTATCCGAACTCCTCATGGAGCTCTAGAGACTTCAAGCTGAGGTCAGCAAAAGCATCTCCCAACTGCCTCTGGGTCTGTACCATCTGGAAGAACTGCGTGGAGAGAGTTTGTGCCAGCTTCAGAACATTCTCGTAACTTCTTTTGTTATCTCCAAAGATTTCTAACTGGGACCTCGGCTCCCGGGTCACTGTTTTGGAACCACGACCTAGTTTCCTCAAAAAGAAATCGGGCCCGTAAACCTTTGAAGGGGTTTAAGGCTCCCTTCTTTCTAACAAACCTCCAATTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCTCTTCCAACCAGGAT