ORFeome > c15orf57 ORF1 – XORFeome v1.0

c15orf57 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c15orf57
Gene ID: 6253935
Gene Page ID: 969347
ORF Xenbase ID: 17266851

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141758
Original XGC clone length: 555

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ838880
dbEST ID: 79656582
Trimmed Sequence: ATGATTGACAACATAGAGTGCAATGGATCTGTGTCTGGACAGGACATTTGGGCAGAGATTTGTCCATGCCCGGATGGAGCCCAACCTTTACATGTCACAGAGGCTTTTTCTGACTCATTCCTGTGCAATCCTCCTGAGGGAAATACTGATAAGGAATTGCAGAATTCTGAGTCTCCTGATATGGAAATTGATTCCCTCTGCACTAACCAAAAGCCTTGGGCTCCATTACAAGACTCTGAGGTTTATCTTGCATCCCTAGAACGAAAGCTGCAGAAGATTAAAGGACACTCCAGAGAAGTTACCTCCAAAGAAATGCTGCACTCGCTTGGACAGGCTAAGAAAGAATCGTGGGACAGGTTCCTGCAGGAGAATCTGGAATCTGAAGCATATGTGGAAGACTGTGAAGTGGATTACAGCTCACTGGAACATCTAAGAAGGTGGCTGCAGCCAGAGAAGGTTGCCATAAACACAGAGGAGGTGCAGCATCTTATTCCAGCAGAATCTCTAACAGAGAAAGCAGAAAATGAGCAGGACTCTACATCTCCCGAAAAATT
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTGACAACATAGAGTGCAATGGATCTGTGTCTGGACAGGACATTTGGGCAGAGATTTGTCCATGCCCGGATGGAGCCCAACCTTTACATGTCACAGAGGCTTTTTCTGACTCATTCCTGTGCAATCCTCCTGAGGGAAATACTGATAAGGAATTGCAGAATTCTGAGTCTCCTGATATGGAAATTGATTCCCTCTGCACTAACCAAAAGCCTTGGGCTCCATTACAAGACTCTGAGGTTTATCTTGCATCCCTAGAACGAAAGCTGCAGAAGATTAAAGGACACTCCAGAGAAGTTACCTCCAAAGAAATGCTGCACTCGCTTGGACAGGCTAAGAAAGAATCGTGGGACAGGTTCCTGCAGGAGAATCTGGAATCTGAAGCATATGTGGAAGACTGTGAAGTGGATTACAGCTCACTGGAACATCTAAGAAGGTGGCTGCAGCCAGAGAAGGTTGCCATAAACACAGAGGAGGTGCAGCATCTTATTCCAGCAGAATCTCTAACAGAGAAAGCAGAAAATGAGCAGGACTCTACATCTCCCGAAAAATTGCCAACTTTCTTGTACAAAGTTGGCATTAATAAAAAACATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAAATCAAAATAAAATCATTAATTGCCCTCCCACCTGATATTCCCCTATAGTTGAGTCCGTATTTTAAAAAAAAAGAAAAAGAAATAAGGGTCACTTTTTGGCCCCTTGTCTTCAAATGGCCCAGAAATGTTAACAAAAATAAAGGGTCCCCCGGGTGGTCGGGGGGGGGTCCTCTTTTTTTTGTGAAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTGACAACATAGAGTGCAAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838879
dbEST ID: 79656581
Trimmed Sequence: TTTTTCTGGAGATGTAGAGTCCTGCTCATTTTCTGCTTTCTCTGTTAGAGATTCTGCTGGAATAAGATGCTGCACCTCCTCTGTGTTTATGGCAACCTTCTCTGGCTGCAGCCACCTTCTTAGATGTTCCAGTGAGCTGTAATCCACTTCACAGTCTTCCACATATGCTTCAGATTCCAGATTCTCCTGCAGGAACCTGTCCCACGATTCTTTCTTAGCCTGTCCAAGCGAGTGCAGCATTTCTTTGGAGGTAACTTCTCTGGAGTGTCCTTTAATCTTCTGCAGCTTTCGTTCTAGGGATGCAAGATAAACCTCAGAGTCTTGTAATGGAGCCCAAGGCTTTTGGTTAGTGCAGAGGGAATCAATTTCCATATCAGGAGACTCAGAATTCTGCAATTCCTTATCAGTATTTCCCTCAGGAGGATTGCACAGGAATGAGTCAGAAAAAGCCTCTGTGACATGTAAAGGTTGGGCTCCATCCGGGCATGGACAAATCTCTGCCCAAATGTCCTGTCCAGACACAGATCCATTGCACTCTATGTTGTCAATCATGG
Full Trace Sequence: ACAAGTCTATTGAACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTCTGGAGATGTAGAGTCCTGCTCATTTTCTGCTTTCTCTGTTAGAGATTCTGCTGGAATAAGATGCTGCACCTCCTCTGTGTTTATGGCAACCTTCTCTGGCTGCAGCCACCTTCTTAGATGTTCCAGTGAGCTGTAATCCACTTCACAGTCTTCCACATATGCTTCAGATTCCAGATTCTCCTGCAGGAACCTGTCCCACGATTCTTTCTTAGCCTGTCCAAGCGAGTGCAGCATTTCTTTGGAGGTAACTTCTCTGGAGTGTCCTTTAATCTTCTGCAGCTTTCGTTCTAGGGATGCAAGATAAACCTCAGAGTCTTGTAATGGAGCCCAAGGCTTTTGGTTAGTGCAGAGGGAATCAATTTCCATATCAGGAGACTCAGAATTCTGCAATTCCTTATCAGTATTTCCCTCAGGAGGATTGCACAGGAATGAGTCAGAAAAAGCCTCTGTGACATGTAAAGGTTGGGCTCCATCCGGGCATGGACAAATCTCTGCCCAAATGTCCTGTCCAGACACAGATCCATTGCACTCTATGTTGTCAATCATGGTGCCAACTTTTTTGTACAAAGTTTGCATTAATAAAAAGCATTGCTCATCAATTTGTGCCAACGAACAGGTCGCTATCCATTCAAAAAAAAAACATAAATTAACAACCGAGGCTAGGACCGGATCTCCTTTCCGCGCACCCATGGAACTGGGAGGGGCCCCCCCGGGGGATCGGGGGCTCCTATTATGTGATATTGTTTTGGGGAACAACCCCCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTCTGGAGATGTAGAGTCCTG