ORFeome > calcoco1 ORF1 – XORFeome v1.0

calcoco1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: calcoco1
Gene ID: 6251912
Gene Page ID: 1189629
ORF Xenbase ID: 17267469

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108760
Original XGC clone length: 1644

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ837752
dbEST ID: 79655454
Trimmed Sequence: ATGGAAAATATATCTCAACCTCAGCTTCCAATGGGGGTCAGCTTTCTGAATGTTGCTCATACCTATGTACCAAATACTAAAGTGGAGTGTCATTATACTATCCCTTTTGGCATGAAGAGTTCTACTAGAGATTGGATAGGAATCTTTAAAGTAAACACTTCATCTATACGGGATTATGAAACATTTGTCTGGGCTGTGCCCCCTGAAAATGCCGGAGAAAGATCAATATCTCATTGCAGTGTCCAGTTTCAAGCCTATTATCTGCCGCATCCTGGAGAACAGCAATACCACTTTCGTTATGTGGATCAGTGTGGCAGTGTGAGAGGATGTAGTGAAGCTTTTGTGTTTGGAGAACCACAGCCTATGGAAGAAATGGTTACCTTGGAAGATGAAGATTCCTGTCTGGATATGCTCTTAATTGTCCCAAAAGCTACTTTCCTTCAGAATCAGCTGGAGATGGCCCAAAAGGAGAGAAATGATCTCATGAGGGCTAGGCTTGCTTTAGAGGAGGAAGTGATCTCAAAAGAGAAAAGAATCTGCTATCTTGAAGCTGCATTAGACATTTCAGAAAAGACATGTTTCTCTTTGAAAGAGCAGTGTGAGGATCTTGTTACGAGAGAACAAATTGCGATAGGAGAAAGAAACTTCTCAACTGTCAGGAAGCAGAGTTACGTGAAACGATTTTGCAACTTTGAAATGAAATTCGAGTATAAAAA
Full Trace Sequence: GAGGGGCCCAAATAATTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAAATATATCTCAACCTCAGCTTCCAATGGGGGTCAGCTTTCTGAATGTTGCTCATACCTATGTACCAAATACTAAAGTGGAGTGTCATTATACTATCCCTTTTGGCATGAAGAGTTCTACTAGAGATTGGATAGGAATCTTTAAAGTAAACACTTCATCTATACGGGATTATGAAACATTTGTCTGGGCTGTGCCCCCTGAAAATGCCGGAGAAAGATCAATATCTCATTGCAGTGTCCAGTTTCAAGCCTATTATCTGCCGCATCCTGGAGAACAGCAATACCACTTTCGTTATGTGGATCAGTGTGGCAGTGTGAGAGGATGTAGTGAAGCTTTTGTGTTTGGAGAACCACAGCCTATGGAAGAAATGGTTACCTTGGAAGATGAAGATTCCTGTCTGGATATGCTCTTAATTGTCCCAAAAGCTACTTTCCTTCAGAATCAGCTGGAGATGGCCCAAAAGGAGAGAAATGATCTCATGAGGGCTAGGCTTGCTTTAGAGGAGGAAGTGATCTCAAAAGAGAAAAGAATCTGCTATCTTGAAGCTGCATTAGACATTTCAGAAAAGACATGTTTCTCTTTGAAAGAGCAGTGTGAGGATCTTGTTACGAGAGAACAAATTGCGATAGGAGAAAGAAACTTCTCAACTGTCAGGAAGCAGAGTTACGTGAAACGATTTTGCAACTTTGAAATGAAATTCGAGTATAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAATATATCTCAACCTCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837751
dbEST ID: 79655453
Trimmed Sequence: CCATGAATCAGGGTTATCCTCAGGGAGAGGCTGCAGTTGACAAGCAATTGGTGCAGGTTGGTTTATTACCACCTTCTGAGGCTCACATGGAAACACAGGGAGGTTCAAGGAGAGGTCCTGTTCATCCAAGGAACATGGTCCAAGCTGCTGAGATACTCCCTCATCTCCAGGGGATTCGTCATCTGAGTCAGAAAGATCCACTGATAAAGTTGGAGGACTTGAGTCTGTTTTGTCTTCCATAAGCATTTTATCTTCTTTCCATTTCTCATCAGCAAGCTTGTCTAGACGTTCTTCCAGCCTACGTACATACTGATGAATTTCCTGCCTCTCCTCTATCAGTTGCTCCTTCTCCATCTGTGTAACTTTTAGGGCAGATTTCAATTCACTCAGCTCTCGTCTGTTCTCTGATAACTGCACCTGTCTGGCATCTGTTTCCTGGTTTAGCTTACACTGCAGTGCATGCCTCTGACTTCTCTCTTCCTGCAGACTGTTATCCAGGCTTAGTTTTTCTGCTTTCAAATTCACAATCTGATCCCTCTTGGCCTCCATGCTGTGATTTAAAGCAGTCTTCTCCTGCCACCACTGCCCCATCCCTTCCTTAAACTTCACGCTCAGATCAGACACCTTAATGGCAAGGTCAGCTGTTTCAAGGCGGCTTTTGTGAAGATCAGATATAGTACAGTCTCGAATGGAAGACATTGATGCCAGCTCCTCCCCCATCAGAAGAGCTTTCTGCTGGCTTGAGGAAAGCATATCCTGAGAGCTCCGTAGTTTCTCTCGCAATGAGTCCACTTGTAGCTGGTAGCGCTCAATTTCCACTGGTGTCTCTCCAAGACGTTGCTTTAACTCCCCCTTTTTCATCTCTAAAAAAACTTTATTGCGACTGTACCTTTCAGCACCCTATCCTTTTCCTGCATCTTCTTAATCATACTCCGAATTTTCCTCTCAATTTCGAAAAACCCGTTCAACTAACTCTTGCCTTCCGGACAGTTGGAAAAAGGTTTCCTTTCCTCTAATCCCAATTTTGTTCTCTCCCGTAACAAAAATCCTCTCCACCGGGCCCTTTCTAAAAAAAAAAACATTGTCTTTTTCTGTTAAAAAGGTCAAAAGGCCACCCCTCCCAAAA
Full Trace Sequence: GGCCAGGGCAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCATGAATCAGGGTTATCCTCAGGGAGAGGCTGCAGTTGACAAGCAATTGGTGCAGGTTGGTTTATTACCACCTTCTGAGGCTCACATGGAAACACAGGGAGGTTCAAGGAGAGGTCCTGTTCATCCAAGGAACATGGTCCAAGCTGCTGAGATACTCCCTCATCTCCAGGGGATTCGTCATCTGAGTCAGAAAGATCCACTGATAAAGTTGGAGGACTTGAGTCTGTTTTGTCTTCCATAAGCATTTTATCTTCTTTCCATTTCTCATCAGCAAGCTTGTCTAGACGTTCTTCCAGCCTACGTACATACTGATGAATTTCCTGCCTCTCCTCTATCAGTTGCTCCTTCTCCATCTGTGTAACTTTTAGGGCAGATTTCAATTCACTCAGCTCTCGTCTGTTCTCTGATAACTGCACCTGTCTGGCATCTGTTTCCTGGTTTAGCTTACACTGCAGTGCATGCCTCTGACTTCTCTCTTCCTGCAGACTGTTATCCAGGCTTAGTTTTTCTGCTTTCAAATTCACAATCTGATCCCTCTTGGCCTCCATGCTGTGATTTAAAGCAGTCTTCTCCTGCCACCACTGCCCCATCCCTTCCTTAAACTTCACGCTCAGATCAGACACCTTAATGGCAAGGTCAGCTGTTTCAAGGCGGCTTTTGTGAAGATCAGATATAGTACAGTCTCGAATGGAAGACATTGATGCCAGCTCCTCCCCCATCAGAAGAGCTTTCTGCTGGCTTGAGGAAAGCATATCCTGAGAGCTCCGTAGTTTCTCTCGCAATGAGTCCACTTGTAGCTGGTAGCGCTCAATTTCCACTGGTGTCTCTCCAAGACGTTGCTTTAACTCCCCCTTTTTCATCTCTAAAAAAACTTTATTGCGACTGTACCTTTCAGCACCCTATCCTTTTCCTGCATCTTCTTAATCATACTCCGAATTTTCCTCTCAATTTCGAAAAACCCGTTCAACTAACTCTTGCCTTCCGGACAGTTGGAAAAAGGTTTCCTTTCCTCTAATCCCAATTTTGTTCTCTCCCGTAACAAAAATCCTCTCCACCGGGCCCTTTCTAAAAAAAAAAACATTGTCTTTTTCTGTTAAAAAGGTCAAAAGGCCACCCCTCCCAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCATGAATCAGGGTTATCCTC