ORFeome > cat.2 ORF1 – XORFeome v1.0

cat.2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cat.2
Gene ID: 976961
Gene Page ID: 976954
ORF Xenbase ID: 17267787

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054964
Original XGC clone length: 1587

Human orthology & disease relationships

NCBI Entrez ID: 847
Ensembl gene IDs: ENSG00000121691
Directly associated (OMIM) disease MIM numbers: 614097
Indirectly associated (Lage, et al.) disease MIM numbers: 131950,151100,163950,163955,202370,214100,226670,262500,278300,600462,605258,607785

Library Location

Plate ID: GDExl11002
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ839333
dbEST ID: 79657035
Trimmed Sequence: ATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGAATGGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGCAACCCTATATCCGACAAGCTTAATCTCCTGACCGTCGGCCCTCGGGGACCCCTGTTGGTGCAAGATGTGGTATTCACTGATGAAATGGCACATTTCGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGTGCTTTCGGCTATTGTGAGGTCACGCATGACATCACGAAATACAGCAAGGCCAAGGTGTTTGAGAACATTGGGAAGAGAACTCCAATTGCCGTGCGGTTCTCCACTGTCGCCGGAGAGGCCGGCTCTTCTGACACAGTACGAGACCCCCGAGGCTTCGCTGTTAAGATGTACACAGAGGACGGGAACTGGGATCTGACTGGAAACAACACCCCCGTCTTTTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTGAAGGACCCAGATATGGTGTGGGATTTCTGGTCTCTGCGTCCCGAGTCTCTTCACCAGGTTTCCTTCCTGTTTTCTGACCGTGGTATTCCCAGATGGTCCCCGCCACTTGAATGGCTACGGGATCCACACCTTTCAAGCTTAGTCCATGCCCAAAAATGAAGCTGTCTTATGGGAATTTCCATTTCAAAAACGAACCAATGGGTCCCCAAACCCTCCACAGTGGGAATGAAACCAAAACCCAATTTGCCTTTCCCCCCCCACCCCCTTAAACCAACCGGGGAAT
Full Trace Sequence: TCGGGGGCCCCAATAAGTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGAATGGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGCAACCCTATATCCGACAAGCTTAATCTCCTGACCGTCGGCCCTCGGGGACCCCTGTTGGTGCAAGATGTGGTATTCACTGATGAAATGGCACATTTCGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGTGCTTTCGGCTATTGTGAGGTCACGCATGACATCACGAAATACAGCAAGGCCAAGGTGTTTGAGAACATTGGGAAGAGAACTCCAATTGCCGTGCGGTTCTCCACTGTCGCCGGAGAGGCCGGCTCTTCTGACACAGTACGAGACCCCCGAGGCTTCGCTGTTAAGATGTACACAGAGGACGGGAACTGGGATCTGACTGGAAACAACACCCCCGTCTTTTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTGAAGGACCCAGATATGGTGTGGGATTTCTGGTCTCTGCGTCCCGAGTCTCTTCACCAGGTTTCCTTCCTGTTTTCTGACCGTGGTATTCCCAGATGGTCCCCGCCACTTGAATGGCTACGGGATCCACACCTTTCAAGCTTAGTCCATGCCCAAAAATGAAGCTGTCTTATGGGAATTTCCATTTCAAAAACGAACCAATGGGTCCCCAAACCCTCCACAGTGGGAATGAAACCAAAACCCAATTTGCCTTTCCCCCCCCACCCCCTTAAACCAACCGGGGAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACAAGAGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839332
dbEST ID: 79657034
Trimmed Sequence: CAGGTTGGCTTTGTCCTTAGAAGTGGCGTAAGAGGAATGCTGGGTGTAGGTCTTCACAGTTTTCTTCTTTGCCCCCTCAGCGTTGTACTTATCCAACAAAGCCTGGATCCGGGCACCATACTCAGGGTGAACATCAGTGAAATTTTTCACAGCTCTCTTCTGTATGAATAGCTGAGCATCCTTCAGGTGTCCAGCAATGTTCTCACATAGACGCAGACGCTGCTCTTCACTTAGAACTTTCACGTAAAAGTCCCGCACCTGTGAAACATTGTCCTCATCAGAGCTATTGTAGCGAGCAACATCGGCCGACACCTGGAATCTGTGCTCCCTCACTTGAGGTTGGTTCTCAGGAGCACAGAAGCTGTTGGGATAATAGTTCGGAGCTCCACCCTGATTGTCCGTAAAGCACATGGGTCTATCCCGCTGGTAATTGGCCACCCGAGTTCTGTAAGGGCAGTTTACAGGCAGTTGCAGATAATTTGGCCCCAAGCGATGTCTGTGAGTGTCCGGGTAGGAGAAAAGTCGCCCCTGCAGCATCTTATCTGGGCTGGGCTCAATGCCAGGNGGCATGTTACTTGGATCAAAAGCCAGCTGCTCCACCTCTGCAAAGTAGTTGGTTTGGGTTTCTGTTTAGCACCAGTTTACCCCACAGGAGTGAGTGGATAATCGCCGGGTGGCCCGAATTTTTGTTTAATTCAAAGGGATTGGAACTTGAATCTCTCCGCCTTTGCTCAAAAGTCCTTGAACCTGGAATGTAAAAAAACC
Full Trace Sequence: CGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGTTGGCTTTGTCCTTAGAAGTGGCGTAAGAGGAATGCTGGGTGTAGGTCTTCACAGTTTTCTTCTTTGCCCCCTCAGCGTTGTACTTATCCAACAAAGCCTGGATCCGGGCACCATACTCAGGGTGAACATCAGTGAAATTTTTCACAGCTCTCTTCTGTATGAATAGCTGAGCATCCTTCAGGTGTCCAGCAATGTTCTCACATAGACGCAGACGCTGCTCTTCACTTAGAACTTTCACGTAAAAGTCCCGCACCTGTGAAACATTGTCCTCATCAGAGCTATTGTAGCGAGCAACATCGGCCGACACCTGGAATCTGTGCTCCCTCACTTGAGGTTGGTTCTCAGGAGCACAGAAGCTGTTGGGATAATAGTTCGGAGCTCCACCCTGATTGTCCGTAAAGCACATGGGTCTATCCCGCTGGTAATTGGCCACCCGAGTTCTGTAAGGGCAGTTTACAGGCAGTTGCAGATAATTTGGCCCCAAGCGATGTCTGTGAGTGTCCGGGTAGGAGAAAAGTCGCCCCTGCAGCATCTTATCTGGGCTGGGCTCAATGCCAGGNGGCATGTTACTTGGATCAAAAGCCAGCTGCTCCACCTCTGCAAAGTAGTTGGTTTGGGTTTCTGTTTAGCACCAGTTTACCCCACAGGAGTGAGTGGATAATCGCCGGGTGGCCCGAATTTTTGTTTAATTCAAAGGGATTGGAACTTGAATCTCTCCGCCTTTGCTCAAAAGTCCTTGAACCTGGAATGTAAAAAAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGTTGGCTTTGTCCTT