ORFeome > ccna1 ORF2 – XORFeome v1.0

ccna1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256478
Gene Page ID:
ORF Xenbase ID: 17268189

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC111510
Original XGC clone length: 516

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ837211
dbEST ID: 79654913
Trimmed Sequence: ATGTGCGAGAGCTACTCACGCTCGCTGTTGCGGGTGTCGGTGGCACAAATCTGCCAAGCTCTGGGATGGGATTCCGTTCAGGTTACCGCCTGCGACCTGCTCACCGATGTGTTGCAAAGATATCTGCAGCAGCTGTGCCGTGGAGCTCACCGCTATTCCGAACTATATGGACGTACAGATCCAGTTTTGGACGATGTTGGTCAAGCTTTCAAGTTGATGGGAGTAAATATTAACGAACTAGAAGACTATATACACAATATAGAACCAGTGACTTTTCCTCATCCAATCCCTTCCTTCCCTGTCAGTAAGAATAATGCTCTTCAGTTCCCTCCTCCTGGAAGCAAGGATGCAGAGGACAGAAAAGCATATATCCCAGATTACTTGCCTCTTATCATCTCTTCACAAGAAGCCTGCGACCAGCCCGCATATTTAGCCACTTTGATCCACTACCCAACCCGCAACTGCCTTATCCGCAACCTGCCGACCACTATCAAACAGGAAGTGACGATGCTCTT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGCGAGAGCTACTCACGCTCGCTGTTGCGGGTGTCGGTGGCACAAATCTGCCAAGCTCTGGGATGGGATTCCGTTCAGGTTACCGCCTGCGACCTGCTCACCGATGTGTTGCAAAGATATCTGCAGCAGCTGTGCCGTGGAGCTCACCGCTATTCCGAACTATATGGACGTACAGATCCAGTTTTGGACGATGTTGGTCAAGCTTTCAAGTTGATGGGAGTAAATATTAACGAACTAGAAGACTATATACACAATATAGAACCAGTGACTTTTCCTCATCCAATCCCTTCCTTCCCTGTCAGTAAGAATAATGCTCTTCAGTTCCCTCCTCCTGGAAGCAAGGATGCAGAGGACAGAAAAGCATATATCCCAGATTACTTGCCTCTTATCATCTCTTCACAAGAAGCCTGCGACCAGCCCGCATATTTAGCCACTTTGATCCACTACCCAACCCGCAACTGCCTTATCCGCAACCTGCCGACCACTATCAAACAGGAAGTGACGATGCTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAATCGAAATACATGGGTCAAAAAAAAAAAAAAAAAAAAAAAAGACACAGTCTCACACAACCCCAAAAGTTAAAAAANNNGNGGNTTTTTTTTCTTTCCTGGCGTCCCCGGGGAGGGGGGGGGGGGGACCTTTTTAGGTGGAGGGGGGAGGGCAACCCCCTCTCCCAGGAGAAAAAACCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCGAGAGCTACTCA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGAATATGCTATGGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGCATCGTCACTTCCTGTTTGATAGTGGTCGGCAGGTTGCGGATAAGGCAGTTGCGGGTTGGGTAGTGGATCAAAGTGGCTAAATATGCGGGCTGGTCGCAGGCTTCTTGTGAAGAGATGATAAGAGGCAAGTAATCTGGGATATATGCTTTTCTGTCCTCTGCATCCTTGCTTCCAGGAGGAGGGAACTGAAGAGCATTATTCTTACTGACAGGGAAGGAAGGGATTGGATGAGAAAAAGTCACTGGTTCTATATTGTGTGTATAGGCTTCTAGTTCGTTAATATTTACTCACATCAACTTGAAGGACAGACCAACATCGTCCAAAACTAGATGTGTACGTCCAAATAGTTCCGAGTAGCGATGAGCGCCTGCGGCGAGCTGCTGCAGGATATCTTTNCACACATCGNTGAGCAAGGCGCAGGCGGGAAGCGAAACGGAATCCCGTGCGAAAGCTGGGCGGGGTGGGGACGGGGGCACGCCGAGGAANAAGANAGGAGTGCGGCTCACGCGTGGTNNCGGGTTTTTGAGTGNAAGGTGNNGTGAGAAGAANCGATGGTGGGGGGGTNNAGGGGCAGGCGGGGGGGGGGGGGGTGGGNNNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATATTTAATTCGTCGTCTGTTAAAAGCACGGCGGGGGAAAATATACCCAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCATCGTCACTTCCTGTT