ORFeome > cdc23 ORF1 – XORFeome v1.0

cdc23 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdc23
Gene ID: 1015909
Gene Page ID: 1015903
ORF Xenbase ID: 17268579

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056107
Original XGC clone length: 1743

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ824729
dbEST ID: 79642431
Trimmed Sequence: ATGGCGGCGACAATCGGGATGTTTTCTGATTTAAAGGAAATCAAGAGGCAGCTGCTAAGCGTAACCTGGCTGTGTCGGGAGAGAGGTCTGATGAATAGCGTCAAATGGGCATCAGAACTTGCTTTCTCTCTCGAATCTGTTCCTCTGAATGAGCTTCCCTCAACCCCAGCACTTACAGAGGAGGATGCCCAGGATCTGGATGCATACATGCTTGCTAAGTCTTACTTTGACCTTAAAGAATATGATCGAGCTGCATATTTTCTTCGGGGGTGTAAGAGCCAAAAAGCCTATTTCATGTACATGTACTCCAGGTACTTGTCTGGAGAAAAGAAGAAGGATGATGAAACAGTTGATAGCCTTGGTCCCCTTGAAAAAGGGCAGGTGAAGAATGAAGCTCTGCGGGAAGTACGTGTGGAGCTGAGTAAGAAGCATAAAGCCAGGGAATTAGATGGATTTGGACTGTACCTGTATGGCGTTGTCTTGAGGAAGCTGGATCTGGCAAAAGAAGCTTTAGATGTATTTGTGGAAGCAACACATGTCTTGCCCTTGCATTGGGGAACCTGGCTGGAATTATGCAATTTGATTACTGACAAAGAGATGCTGAAGTTCCTGTCTCTGCCAGACTCATGGATAAAGGAATTTTTCTTGGCACACATATACACAGAGCTGCAGTTGATTGAGGAGGCATTGCAGAAATACCAAAGTCTTATTGATGCTGGCTTCTCCAAGAGTACTTACATTATATCCCAAATTGCCGGTTGCCTACAATAACATCCCGGGAAAATGGACAAAGCCTCTGGTCTAATTTTCCTNTGGAACTTGTCGGAGAAC
Full Trace Sequence: AAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGACAATCGGGATGTTTTCTGATTTAAAGGAAATCAAGAGGCAGCTGCTAAGCGTAACCTGGCTGTGTCGGGAGAGAGGTCTGATGAATAGCGTCAAATGGGCATCAGAACTTGCTTTCTCTCTCGAATCTGTTCCTCTGAATGAGCTTCCCTCAACCCCAGCACTTACAGAGGAGGATGCCCAGGATCTGGATGCATACATGCTTGCTAAGTCTTACTTTGACCTTAAAGAATATGATCGAGCTGCATATTTTCTTCGGGGGTGTAAGAGCCAAAAAGCCTATTTCATGTACATGTACTCCAGGTACTTGTCTGGAGAAAAGAAGAAGGATGATGAAACAGTTGATAGCCTTGGTCCCCTTGAAAAAGGGCAGGTGAAGAATGAAGCTCTGCGGGAAGTACGTGTGGAGCTGAGTAAGAAGCATAAAGCCAGGGAATTAGATGGATTTGGACTGTACCTGTATGGCGTTGTCTTGAGGAAGCTGGATCTGGCAAAAGAAGCTTTAGATGTATTTGTGGAAGCAACACATGTCTTGCCCTTGCATTGGGGAACCTGGCTGGAATTATGCAATTTGATTACTGACAAAGAGATGCTGAAGTTCCTGTCTCTGCCAGACTCATGGATAAAGGAATTTTTCTTGGCACACATATACACAGAGCTGCAGTTGATTGAGGAGGCATTGCAGAAATACCAAAGTCTTATTGATGCTGGCTTCTCCAAGAGTACTTACATTATATCCCAAATTGCCGGTTGCCTACAATAACATCCCGGGAAAATGGACAAAGCCTCTGGTCTAATTTTCCTNTGGAACTTGTCGGAGAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGACAATCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ830081
dbEST ID: 79647783
Trimmed Sequence: TGGTGTGACCGATGAAAGGTTAAGTGGAGACACTCTTCTTGTAGGGGTGTTGTTGGCAGAAAGGGATTGTGGAAGGAAGAAAGGAGCAGTGGCTGGCTCAGCCGATGGACTTTCACTTTGGTTCCTTAACTGTAGAATCTGGCGTAGAAGAGCTTTGCCTTCTTCCCTGGTATCATTAAAATTGAAGCATTTCTGGGCACATGCAGATGCCTCATCCCACAGCTTGCACTTGAAGTAATACTGAGCCAGATAGCGAAAGGCCGTGCTGACCTCCTGATGCTCCACAATTTCCCCACAGGAGTAGATGTCTTGTATGTACTTGATGTAACACTGGGCAGCCTGTTCCGATTCGTTCAGTTGTTCATGAAGCTTTGCCAGCTTGACGAGAGCCATTTTCTCCACATCACCCACAGCATAAGCTCTCCAGTAACATTTTTTAGCCTCCACAAGTTGATTAAGCTTTTCATAACATTCCCCCAAAGCTACAAGCATTCTCGAGTCGTTGGGCCTTAGCTGATGGGCCCGTCTATAATAATAAAGGCAGTAAAATGGCATCTTCAAAATTTCATAGGTTTGTCCTAATCCGTACCAAGCGCGATAATCTCTCTTGTTCACTTCAATCGCATGCCCTGTAGCCTGTATTGCTGCAGAGGTGTTCTTCATTCCCATATATTCGGTGTCCCATGAGAGTCCAAGCACCAAGAATATCAAGGGGTTTGAGTTTTTAGTGGCCCCTTTGGGAAATTACCAGGGGGCGGC
Full Trace Sequence: GACGGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGTGTGACCGATGAAAGGTTAAGTGGAGACACTCTTCTTGTAGGGGTGTTGTTGGCAGAAAGGGATTGTGGAAGGAAGAAAGGAGCAGTGGCTGGCTCAGCCGATGGACTTTCACTTTGGTTCCTTAACTGTAGAATCTGGCGTAGAAGAGCTTTGCCTTCTTCCCTGGTATCATTAAAATTGAAGCATTTCTGGGCACATGCAGATGCCTCATCCCACAGCTTGCACTTGAAGTAATACTGAGCCAGATAGCGAAAGGCCGTGCTGACCTCCTGATGCTCCACAATTTCCCCACAGGAGTAGATGTCTTGTATGTACTTGATGTAACACTGGGCAGCCTGTTCCGATTCGTTCAGTTGTTCATGAAGCTTTGCCAGCTTGACGAGAGCCATTTTCTCCACATCACCCACAGCATAAGCTCTCCAGTAACATTTTTTAGCCTCCACAAGTTGATTAAGCTTTTCATAACATTCCCCCAAAGCTACAAGCATTCTCGAGTCGTTGGGCCTTAGCTGATGGGCCCGTCTATAATAATAAAGGCAGTAAAATGGCATCTTCAAAATTTCATAGGTTTGTCCTAATCCGTACCAAGCGCGATAATCTCTCTTGTTCACTTCAATCGCATGCCCTGTAGCCTGTATTGCTGCAGAGGTGTTCTTCATTCCCATATATTCGGTGTCCCATGAGAGTCCAAGCACCAAGAATATCAAGGGGTTTGAGTTTTTAGTGGCCCCTTTGGGAAATTACCAGGGGGCGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGTGTGACCGATGAAAG