ORFeome > cgrrf1 ORF1 – XORFeome v1.0

cgrrf1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cgrrf1
Gene ID: 1004762
Gene Page ID: 1004755
ORF Xenbase ID: 17269311

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078554
Original XGC clone length: 1005

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ839634
dbEST ID: 79657336
Trimmed Sequence: ATGCCGACTTTATTGCTGGCCACATTATACGAATATTCCCCGCTGTTCTACATCACCGTGGTGTTTGTCTGCTTTGTGGTTACCTCTGGCTTCGTTCTGGGATGGTTTCGTTTGGATGTTCCCGTTATTCTGAGAAACTCAGAAGAAGCATATTCTACAAGCTTTGTTTCCAAAAAGCAGATGAGGCAAGTGAAGAATCCTTTTGGCTTGGAAATCACAAATCCAGATGTAGCTTCAGTAACAAGTGGCATATCATTAACCCCAAACTGCCTGGAGAACTGTGTCCTGACCTATTACTGGGGTTGTAGTGTTCAAAAGCTCCAAGAAGCTTTGCAGCATCACTTGTATTGCTTTATAATCAAAACTCCGACAGCACTGGAAAATGCCCTCTTTGGGGAATATCTACATAAAGAGCAGCATGTCGTCCAGAAACATGACAAAGAAGAAATATTTACCCAGTTGCCACCTGACAGCCAGTTAAAGGATTTTGGCCCCTTGCCACGGACACGTTACCCACTTGTGGCATTTCTAACACTGTCTGATGAAGAAGACAGGGAGTCATATGATATTGTATCAATGCTGGCTGTGGTTCATGTACCTGACAGAAGTTACAGACTATCCTGTAGAATAATGTACCAATACCTGCTGACTGCGCAAGGACAGTTTTATGACCCTTAGCAACTGTTCATGTCTGCAAATGACAGCCAATTAACATCTACAAGTGCTTCATTCTCACATGAACATACTGTCAAATAAAAACCTGGCTTGGAAAAATTTGGACTCCTTCCAAAGAAGGAAAATGCAAGGAAGAACCCTGGC
Full Trace Sequence: TCGGGGCACCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGACTTTATTGCTGGCCACATTATACGAATATTCCCCGCTGTTCTACATCACCGTGGTGTTTGTCTGCTTTGTGGTTACCTCTGGCTTCGTTCTGGGATGGTTTCGTTTGGATGTTCCCGTTATTCTGAGAAACTCAGAAGAAGCATATTCTACAAGCTTTGTTTCCAAAAAGCAGATGAGGCAAGTGAAGAATCCTTTTGGCTTGGAAATCACAAATCCAGATGTAGCTTCAGTAACAAGTGGCATATCATTAACCCCAAACTGCCTGGAGAACTGTGTCCTGACCTATTACTGGGGTTGTAGTGTTCAAAAGCTCCAAGAAGCTTTGCAGCATCACTTGTATTGCTTTATAATCAAAACTCCGACAGCACTGGAAAATGCCCTCTTTGGGGAATATCTACATAAAGAGCAGCATGTCGTCCAGAAACATGACAAAGAAGAAATATTTACCCAGTTGCCACCTGACAGCCAGTTAAAGGATTTTGGCCCCTTGCCACGGACACGTTACCCACTTGTGGCATTTCTAACACTGTCTGATGAAGAAGACAGGGAGTCATATGATATTGTATCAATGCTGGCTGTGGTTCATGTACCTGACAGAAGTTACAGACTATCCTGTAGAATAATGTACCAATACCTGCTGACTGCGCAAGGACAGTTTTATGACCCTTAGCAACTGTTCATGTCTGCAAATGACAGCCAATTAACATCTACAAGTGCTTCATTCTCACATGAACATACTGTCAAATAAAAACCTGGCTTGGAAAAATTTGGACTCCTTCCAAAGAAGGAAAATGCAAGGAAGAACCCTGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGACTTTATTGCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839633
dbEST ID: 79657335
Trimmed Sequence: GTCTTCTTGAATGGGAGAACTGCTATCACTTGTTGGTGAAGATTGGCTAAATAATGGGAATGACTCCTGAACAAACTGTCTGCATATTGGACAATGTTGGAAGAATCTTAGACATCCATCACACAGGCATACATGCCTACAGGGCAGAAGTACCCAGTTCACTTTGCCATTCTGACACACAACACAGTCTTTGGCAGTGTCCTCCTGCACTTCCTCCTCGGAGAGTCCAAATTTTTCCAGCAGGTCTTTATCTGCAGTACTGTCATGTGAGAATGAAGCACTTGTAGATTGTAATTGGCTGTCATTTGCAGACATGAACAGTTGCTTAAGGTCATAAAACTGTCCTTGCGCAGTCAGCAGGTATTGGTACATTATTCTACAGGATAGTCTGTAACTTCTGTCAGGTACATGAACCACAGCCAGCATTGATACAATATCATATGACTCCCTGTCTTCTTCATCAGACAGTGTTAGAAATGCCACAAGTGGGTAACGTGTCCGTGGCAAGGGGCCAAAATCCTTTAACTGGCTGTCAGGTGGCAACTGGGGAAATATTTCTTCTTTGTCATGTTTCTGGACGACATGCTGCTCTTTATGTAAATATTCCCCCAAAAAGGCATTTTCCAGTGCTGTCGGAGTTTTGATTATAAAGCATAACAATTGATGCCTGCAAAGCTTCCTGGGAACCTTTTGAACACCTACAACCCCCAAAAAATAGCTCAAGAAACCAATTTCCCCCGGGCAGGTTGGGGGGGTTAAAGGAAATTGGC
Full Trace Sequence: GGGAAAATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTTCTTGAATGGGAGAACTGCTATCACTTGTTGGTGAAGATTGGCTAAATAATGGGAATGACTCCTGAACAAACTGTCTGCATATTGGACAATGTTGGAAGAATCTTAGACATCCATCACACAGGCATACATGCCTACAGGGCAGAAGTACCCAGTTCACTTTGCCATTCTGACACACAACACAGTCTTTGGCAGTGTCCTCCTGCACTTCCTCCTCGGAGAGTCCAAATTTTTCCAGCAGGTCTTTATCTGCAGTACTGTCATGTGAGAATGAAGCACTTGTAGATTGTAATTGGCTGTCATTTGCAGACATGAACAGTTGCTTAAGGTCATAAAACTGTCCTTGCGCAGTCAGCAGGTATTGGTACATTATTCTACAGGATAGTCTGTAACTTCTGTCAGGTACATGAACCACAGCCAGCATTGATACAATATCATATGACTCCCTGTCTTCTTCATCAGACAGTGTTAGAAATGCCACAAGTGGGTAACGTGTCCGTGGCAAGGGGCCAAAATCCTTTAACTGGCTGTCAGGTGGCAACTGGGGAAATATTTCTTCTTTGTCATGTTTCTGGACGACATGCTGCTCTTTATGTAAATATTCCCCCAAAAAGGCATTTTCCAGTGCTGTCGGAGTTTTGATTATAAAGCATAACAATTGATGCCTGCAAAGCTTCCTGGGAACCTTTTGAACACCTACAACCCCCAAAAAATAGCTCAAGAAACCAATTTCCCCCGGGCAGGTTGGGGGGGTTAAAGGAAATTGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTTCTTGAATGGGAGAACTG