ORFeome > col2a1 ORF1 – XORFeome v1.0

col2a1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: col2a1
Gene ID: 6252612
Gene Page ID: 6258352
ORF Xenbase ID: 17270265

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044962
Original XGC clone length: 4476

Human orthology & disease relationships

NCBI Entrez ID: 1280
Ensembl gene IDs: ENSG00000139219
Directly associated (OMIM) disease MIM numbers: 108300,132450,150600,151210,156550,183900,184250,200610,215150,271700,604864,608805,609162,609508
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ823816
dbEST ID: 79641518
Trimmed Sequence: ATGTTTAGCTTTGTGGATTCAAGGACTCTAGTGCTGTTCGCAGCCACACAAGTCATTTTATTAGCGGTTGTACGATGCCAAGATGAAGAAGATGTCCTGGATACAGGCAGCTGCGTACGGGATGGGCAGAGGTATAGTGATAAAGATGTGTGGAAACCCGAGCCCTGCCAAATCTGTGTCTGTGACACTGGGACTGTTCTCTGCGATGAAATAATCTGCGAAGAGTCCAAAGATTGCCCCAATGCTGAGATCCCCTTCGGAGAGTGCTGTCCCATCTGCCCAACTGAGCAATCTTCTACCTCCAGTGGGCAAGGAGTGGCCAAGGGACAGAAAGGTGAACCTGGTGATATTAAAGATGTTGTAGGACCAAGAGGACCACCTGGACCACAGGGACCTTCTGGTGAACAAGGACCTAGAGGAGAACGTGGAGATAAGGGCGAGACTGGTGCTCCCGGACCCCGTGGAAGAGATGGCGAACCCGGTACTCCTGGGAACCCAGGACCTGCTGGCCCGCCTGGACCTCCTGGACCCCCTGGCCTTGGCGGAAACTTTGCTGCTCAAATGACAGGAGGATTTGATGNAGAAGCTGGCGGTGCACAAATGGGAGTTATGCAAGGACCAATGGGCCCTATGGGACCAAGAGGACCTCCCGGCCCATCAGGAGCTCCTGGACCTCAAGGTTTCAAGGGCATCCCGGTGAACCTGGTGAATCTGGGTGCTGGTGGGTCTATGGGGTCCTCGTGGTCCTCCCTGGTCCCTTCTGGGAAAGCCCGGG
Full Trace Sequence: TATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTAGCTTTGTGGATTCAAGGACTCTAGTGCTGTTCGCAGCCACACAAGTCATTTTATTAGCGGTTGTACGATGCCAAGATGAAGAAGATGTCCTGGATACAGGCAGCTGCGTACGGGATGGGCAGAGGTATAGTGATAAAGATGTGTGGAAACCCGAGCCCTGCCAAATCTGTGTCTGTGACACTGGGACTGTTCTCTGCGATGAAATAATCTGCGAAGAGTCCAAAGATTGCCCCAATGCTGAGATCCCCTTCGGAGAGTGCTGTCCCATCTGCCCAACTGAGCAATCTTCTACCTCCAGTGGGCAAGGAGTGGCCAAGGGACAGAAAGGTGAACCTGGTGATATTAAAGATGTTGTAGGACCAAGAGGACCACCTGGACCACAGGGACCTTCTGGTGAACAAGGACCTAGAGGAGAACGTGGAGATAAGGGCGAGACTGGTGCTCCCGGACCCCGTGGAAGAGATGGCGAACCCGGTACTCCTGGGAACCCAGGACCTGCTGGCCCGCCTGGACCTCCTGGACCCCCTGGCCTTGGCGGAAACTTTGCTGCTCAAATGACAGGAGGATTTGATGNAGAAGCTGGCGGTGCACAAATGGGAGTTATGCAAGGACCAATGGGCCCTATGGGACCAAGAGGACCTCCCGGCCCATCAGGAGCTCCTGGACCTCAAGGTTTCAAGGGCATCCCGGTGAACCTGGTGAATCTGGGTGCTGGTGGGTCTATGGGGTCCTCGTGGTCCTCCCTGGTCCCTTCTGGGAAAGCCCGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTAGCTTTGTGGATTCAAGG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CCTGTAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAGAAGCAGACTGGGCCAAGAGCACCCGGAGGACCTGCAGACCCGATTTCACCTTTGGGACCATGTTCACCCTTGAAACCTGCGATACCAGGGTCACCTGTCTGGCCTTTGGGACCGACAGGACCCCTAGCTCCTTGAGGTCCTGGTGGACCACGTGGTCCGTGTAAACCATGGGCCCCAGCAATACCACAACCACCAATATGAACCTTTGGCGCCCGGAAGTACCATCAGTACCATGGTTACCGGAAGCTCCAGAATGTCCAGGAGATCCAGGGGTACCAGAGTCTCCTCTGGGTCCTTGATCACCCTCATGGCCACGAGCTCCAATTGGGCCAGCTTCACCCTTTGAGCCAAGGGCACCAGGGAAACCAGGAGCACCAGCAGGGCCAACAGGTCCTGGTGGACCAGCGCGACCAGGGAGACCATGCATTACCACGAGCACCACCAGCACCAGAAGATCCAGGACGTCCTCTCTCACCTATAAGACCACGGGGACCCATTGGACCTCGAGCTCCAGCGTCGCCAAAGACATCACTTTCTCCTTCGGCGCCTGCATCACCTGCTTCACCCTTACCACCATCAAGACCTGCGTAACCGATGTGTCCTTTCACTGCCGGAATTCCTGCGGGGTCCTGGGCAACCTCTAGCCCCCCTGAGGTCCTGGGGGGTCCCGATTCAGCCCATTTCCCCAGGGTTTGACCTTCTTTCTCCACTCGTTCCCCCGGGCTTTTCCCCCAAGGACCCAAGGGGGGAACGCCCCAAGGAACCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAGAAGCAGACTGGGCCAA