ORFeome > dcaf13 ORF1 – XORFeome v1.0

dcaf13 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dcaf13
Gene ID: 5791341
Gene Page ID: 5791288
ORF Xenbase ID: 17271939

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042261
Original XGC clone length: 1338

Human orthology & disease relationships

NCBI Entrez ID: 25879
Ensembl gene IDs: ENSG00000164934
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 137760,604901,609887

Library Location

Plate ID: GDExl11016
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ824291
dbEST ID: 79641993
Trimmed Sequence: ATGAAGGTGAAGGTTCTGTGTAGGAACCCGGACGATTACGTGCGAGAGACCAAGAGAGATCTGCAGAGAGTCCCTCGGAATTATGACCCAGCCCTACACCCGTTTGAAGTGTCACGGGAATATACAAGAGCGTTAAATGCCACCAAGTTGGAGCGGGTCTTTGCCAAGCCTTTTATTGCTTCCCTGGATGGCCATAGAGATGGGGTTAACTGCATTGCCAAGCATCCCAAAAGCTTATCTACCGTGCTGTCAGGAGCATGTGATGGAGAGGTTAAGATTTGGAATTTGACGAAGCGAGAATGTTCTAGAACAATACAAGCACACGATGGCTTTGTGAGAGGACTTTGTGTCCGATTCTGCGGCACCTCGTTCTTTACAGTGGGTGACGATAAGACAGTGAAGCAATGGGCAATGGAAAGCCCTGGTTATGGTGAGAAAGTGGAGCCCATGCGTACAATCTTAGGAAAGACTGTTTTCACAGGGATCGACCATCACGTGAAAGATGCTGTTTTTGCCACTTGTGGGCAGCAAGTGGATATCTGGGATGAACAAAGGTCCGCTCCCATGAGATCATATGCATGGGGGGTTGACAGTATCTCATCAGTCAGATTTAATCCAGTAGAGACACACATTTTATCAAGCTGTGGAACAGACCGAAGCATCGTTCTCTATGATAAGCCGAAACCCCCCCCCCCTAAAAAAATTATTTTGGGAAATGAGAACAAAGGGTCTTGTGTGGGAACCCAATGGGAAGCCTTTGTTTTTCCCTGGGGGCCCATGGAAAATTTCCAACCTTGTTCCACCGTTTTGAAATGGGCCGCTATTTAGGGAAAAGC
Full Trace Sequence: GCCAATATGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGTGAAGGTTCTGTGTAGGAACCCGGACGATTACGTGCGAGAGACCAAGAGAGATCTGCAGAGAGTCCCTCGGAATTATGACCCAGCCCTACACCCGTTTGAAGTGTCACGGGAATATACAAGAGCGTTAAATGCCACCAAGTTGGAGCGGGTCTTTGCCAAGCCTTTTATTGCTTCCCTGGATGGCCATAGAGATGGGGTTAACTGCATTGCCAAGCATCCCAAAAGCTTATCTACCGTGCTGTCAGGAGCATGTGATGGAGAGGTTAAGATTTGGAATTTGACGAAGCGAGAATGTTCTAGAACAATACAAGCACACGATGGCTTTGTGAGAGGACTTTGTGTCCGATTCTGCGGCACCTCGTTCTTTACAGTGGGTGACGATAAGACAGTGAAGCAATGGGCAATGGAAAGCCCTGGTTATGGTGAGAAAGTGGAGCCCATGCGTACAATCTTAGGAAAGACTGTTTTCACAGGGATCGACCATCACGTGAAAGATGCTGTTTTTGCCACTTGTGGGCAGCAAGTGGATATCTGGGATGAACAAAGGTCCGCTCCCATGAGATCATATGCATGGGGGGTTGACAGTATCTCATCAGTCAGATTTAATCCAGTAGAGACACACATTTTATCAAGCTGTGGAACAGACCGAAGCATCGTTCTCTATGATAAGCCGAAACCCCCCCCCCCTAAAAAAATTATTTTGGGAAATGAGAACAAAGGGTCTTGTGTGGGAACCCAATGGGAAGCCTTTGTTTTTCCCTGGGGGCCCATGGAAAATTTCCAACCTTGTTCCACCGTTTTGAAATGGGCCGCTATTTAGGGAAAAGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGTGAAGGTTCTGTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829634
dbEST ID: 79647336
Trimmed Sequence: TTCCACTACAGCCAGCACGTGCTTCTTCTTCTCTGACGGGATTGGCACAGAGCCCGGCTTGCTGTGTTTGCGACGGTTTACATCCTTCTTGCGGCGAGCTTCCCTCATGATCTGCTGCTCCTTTATTTGGCTGTAGATGGACCTCGGTAGGTGCCGGTGGCGAGCGATCCTCTTGATCTGTGGGTGGTGCTGGAACTTCTCCTTCAACTTCTGGTTGTAGTTCTGTGCCGCTCTCTCTCGTGGTGACAACACTCCCAGCTTTTCGGAGGCGTTGGCTTTCCATATGCGAATGTTCATTTCGTCAGAACCGCAGAGAACATACTTGTTGTCGGCAGACCATCTAACACAGGTGACGTGCTGCATCCGCTTTGTGTGATAGACTTCCCTGCTGTGTCCACTTTGCACTGGGAATATACGGATGGACTTATCAAAGCTGGCAGACACAAGCTCCTTTCCAGTAGGGGAGTAATCTACATCCAGAACAGCCGACACGTGATCCATGTGCACCTTCACGGGGCTGTCCATATAGCGCATGTCATACGTGTACAGGTTGAAGTTTTCATTGGCCGCAGTGAAAATAAATGCTTCCATTGGGTTCCACACAGAGCATTTGTTCTCATTTCAAAATATCTTTTTTAATTGGGGTGGTTTTCGCTTATCATAGAGAACGATGCTTCGGTCTGTTCCACAGCTGGAATAAATGTGTGTCTCTTACGGAATAAAAATCTTAATGGATGAAAATACTGTCAACCCCCCCCTGGCAAAATAAACCCA
Full Trace Sequence: CGGGGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCACTACAGCCAGCACGTGCTTCTTCTTCTCTGACGGGATTGGCACAGAGCCCGGCTTGCTGTGTTTGCGACGGTTTACATCCTTCTTGCGGCGAGCTTCCCTCATGATCTGCTGCTCCTTTATTTGGCTGTAGATGGACCTCGGTAGGTGCCGGTGGCGAGCGATCCTCTTGATCTGTGGGTGGTGCTGGAACTTCTCCTTCAACTTCTGGTTGTAGTTCTGTGCCGCTCTCTCTCGTGGTGACAACACTCCCAGCTTTTCGGAGGCGTTGGCTTTCCATATGCGAATGTTCATTTCGTCAGAACCGCAGAGAACATACTTGTTGTCGGCAGACCATCTAACACAGGTGACGTGCTGCATCCGCTTTGTGTGATAGACTTCCCTGCTGTGTCCACTTTGCACTGGGAATATACGGATGGACTTATCAAAGCTGGCAGACACAAGCTCCTTTCCAGTAGGGGAGTAATCTACATCCAGAACAGCCGACACGTGATCCATGTGCACCTTCACGGGGCTGTCCATATAGCGCATGTCATACGTGTACAGGTTGAAGTTTTCATTGGCCGCAGTGAAAATAAATGCTTCCATTGGGTTCCACACAGAGCATTTGTTCTCATTTCAAAATATCTTTTTTAATTGGGGTGGTTTTCGCTTATCATAGAGAACGATGCTTCGGTCTGTTCCACAGCTGGAATAAATGTGTGTCTCTTACGGAATAAAAATCTTAATGGATGAAAATACTGTCAACCCCCCCCTGGCAAAATAAACCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCACTACAGCCAGCAC