ORFeome > ddx54 ORF1 – XORFeome v1.0

ddx54 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ddx54
Gene ID: 1011581
Gene Page ID: 1011575
ORF Xenbase ID: 17272245

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108844
Original XGC clone length: 2541

Human orthology & disease relationships

NCBI Entrez ID: 79039
Ensembl gene IDs: ENSG00000123064
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 146300,214150,222900,241500,241510,601675

Library Location

Plate ID: GDExl11082
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ837245
dbEST ID: 79654947
Trimmed Sequence: ATGGCTCAGAAAAAACGTAAGGCGCAGAGGTCTCGGAAATGCTGTCAACGAACAAGATAGCGACGATAGCGATAAAGGGGAATTTCGTGTCAAAGCTGCACCCCAAAAGGATGATGGAGTACACCTTCCAGCATTTCCCACTGCAGATGCAGGTTCAGATTCAGAAGCAGAACCGGACACCAGAGAGCTGGTTCGAGCACAGAACAAGAAGAAAAAGAAGTCTGGCGGAAAAGCAATGGGTTCAAGAAAGGAAAGACAANAAAATT
Full Trace Sequence: TCGGGGGCCCAATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCAGAAAAAACGTAAGGCGCAGAGGTCTCGGAAATGCTGTCAACGAACAAGATAGCGACGATAGCGATAAAGGGGAATTTCGTGTCAAAGCTGCACCCCAAAAGGATGATGGAGTACACCTTCCAGCATTTCCCACTGCAGATGCAGGTTCAGATTCAGAAGCAGAACCGGACACCAGAGAGCTGGTTCGAGCACAGAACAAGAAGAAAAAGAAGTCTGGCGGAAAAGCAATGGGTTCAAGAAAGGAAAGACAANAAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTACAAAAAAAAAAAAAAAAAAACAAAAAAAAAATATAGCCCCTCTTTAAAGACAAAGAAAGAGAAAAAACAAAAATTTATGGTCCCCCCCGGGAGAGGGGGGGTAGAGGTCGGGGAGGCCGGAGACGGGCGCCCCCCCGTTGGGGGGAGGCCCGGGTGGGGTGGATAAAGATGGAAAAGAGAAAAAACAGTCCCCACCCAACCAGGAGTCTCTAACCATGGTTCGAAACAAGAGGGGGAGTAAAGGCACCAGGTTAGTTTTANNGNTAAAACCACCCTCGGAAATGAAAAATAAAATTANAGATAAAAAACACCAGAGCACGAAAAAACCCANGCNAAACTCACAGATCTTAAAAAAAACCCANATAAAANAGNACAAGGNGNTGCNAANCNNANCGCATANNNATCTNCTTTTNTTNATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCAGAAAAAACGTAAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837244
dbEST ID: 79654946
Trimmed Sequence: TTTTCTTGTCTTTCCTTTCTTGAACCCATTGCTTTTCCGCCAGACTTCTTTTTCTTCTTGTTCTGTGCTCGAACCAGCTCTCTGGTGTCCGGTTCTGCTTCTGAATCTGAACCTGCATCTGCAGTGGGAAATGCTGGAAGGTGTACTCCATCATCCTTTTGGGGTGCAGCTTTGACACGAAATTCCCCTTTATCGCTATCGTCTCTATCTTGTCGTTGACATCATTTCCGAGACCTCTGCGCCTTACGTTTTTTCTGAGCCATGG
Full Trace Sequence: GGGAAACTGCTACTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTCTTGTCTTTCCTTTCTTGAACCCATTGCTTTTCCGCCAGACTTCTTTTTCTTCTTGTTCTGTGCTCGAACCAGCTCTCTGGTGTCCGGTTCTGCTTCTGAATCTGAACCTGCATCTGCAGTGGGAAATGCTGGAAGGTGTACTCCATCATCCTTTTGGGGTGCAGCTTTGACACGAAATTCCCCTTTATCGCTATCGTCTCTATCTTGTCGTTGACATCATTTCCGAGACCTCTGCGCCTTACGTTTTTTCTGAGCCATGGTGCCAACTTTTTTGTACTAAGTTGGCATTATAAAAAATCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATATAATCATTATTTGTGACCCCNANCTTAAAAAAAAAGGAAAAAATCAAAAAGTAACTGACTGCGTGATATAAAGAAAAGCAAAGAATCAAATAAATTACGCTCTACCCAGGGTTGCGGGGGTACCATTCGTGATAAGGGTGAGGGCCGGACCTGGGGGAGAAAACTGCTCGGTCGTATATTTAAGGGGGGGNNGNGAGGGCCCCCAGNGGGGCNCAAAACAAGAAGGGAGGGGGGGGGGAGAGAGANNNGGGGNNNGNNGNNNNNNGGGGAGGNNNNNGNGNNNGNNNGGNNNNNNNNGGGNGNGAAAAANAGANNNGNNNNNNNNNNGNGNGGNNGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTCTTGTCTTTCCTTTCTT