ORFeome > dnase1l3 ORF1 – XORFeome v1.0

dnase1l3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dnase1l3
Gene ID: 6078563
Gene Page ID: 1002678
ORF Xenbase ID: 17272911

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054141
Original XGC clone length: 798

Human orthology & disease relationships

NCBI Entrez ID: 1776
Ensembl gene IDs: ENSG00000163687
Directly associated (OMIM) disease MIM numbers: 614420
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ839170
dbEST ID: 79656872
Trimmed Sequence: ATGTGGCGCCTCCTCCTCTTGTGTGCACTCTGTGTCCCCCACTCTCTGGGGCTCCGAATCTGCTCCTTTAATGTTCAGTCCTTTGGGGAGTCCAAACGGGACAAACCTGCTGTCATGAATGTAGTGAGAAAGATCATTTCCCGCTGTGACATCACACTTCTGATGGAAATCAAGGACAGCAGCAACACCGTCATCCGATTGTTAATGGCACAACTCAACAGGAAGAACCTGGTGTCAGTTAAAGGAACGTACCAATATAAAGACTTGCAGCCGGGAGATGAAGACGCTTTCTCTCGGGAGCCCTATGTGGTTTGGTTTCAAGCTCCTGGCACTGAGGTCAAAGAGTTTGTGATCGTTCCCCAGCACACCACCCCCGAGGCCGCCGTTCGGGAAATCGATGAACTTTATGATGTTGACCTTGATGTCAAACAGAAATGGAACTCAGAGAATTTTATTTTCATGGGAGACCTAAATGCCGGCTGCTCCTACGTGCCCAAGAAATCCTGGAAGAACATCCGTCTCCGGAATCACACCGAGTTCGTTTGGCTGATTGGGGACAACAATGATACGACAGTGAAGTCCAGCACCAACTGTGCCTATGACAGGATTGTCGTTGTTGGTGAGAAGCTGGTCAGCTCCATTGTACCAGGCTCTGCCCATGTCTTTGAATTTATGGTTGCTTATGGGCTGACAAAAGAGCAGGGTCTGGAAGGTAAGTGATCACTTTCCCCTATCAAGTGGCGGCTTGAGGGAAATCAAAACGTTCCAAACTTTCCAGGAAGGAGGA
Full Trace Sequence: CGGGGGATTAACTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGCGCCTCCTCCTCTTGTGTGCACTCTGTGTCCCCCACTCTCTGGGGCTCCGAATCTGCTCCTTTAATGTTCAGTCCTTTGGGGAGTCCAAACGGGACAAACCTGCTGTCATGAATGTAGTGAGAAAGATCATTTCCCGCTGTGACATCACACTTCTGATGGAAATCAAGGACAGCAGCAACACCGTCATCCGATTGTTAATGGCACAACTCAACAGGAAGAACCTGGTGTCAGTTAAAGGAACGTACCAATATAAAGACTTGCAGCCGGGAGATGAAGACGCTTTCTCTCGGGAGCCCTATGTGGTTTGGTTTCAAGCTCCTGGCACTGAGGTCAAAGAGTTTGTGATCGTTCCCCAGCACACCACCCCCGAGGCCGCCGTTCGGGAAATCGATGAACTTTATGATGTTGACCTTGATGTCAAACAGAAATGGAACTCAGAGAATTTTATTTTCATGGGAGACCTAAATGCCGGCTGCTCCTACGTGCCCAAGAAATCCTGGAAGAACATCCGTCTCCGGAATCACACCGAGTTCGTTTGGCTGATTGGGGACAACAATGATACGACAGTGAAGTCCAGCACCAACTGTGCCTATGACAGGATTGTCGTTGTTGGTGAGAAGCTGGTCAGCTCCATTGTACCAGGCTCTGCCCATGTCTTTGAATTTATGGTTGCTTATGGGCTGACAAAAGAGCAGGGTCTGGAAGGTAAGTGATCACTTTCCCCTATCAAGTGGCGGCTTGAGGGAAATCAAAACGTTCCAAACTTTCCAGGAAGGAGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCGCCTCCTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839169
dbEST ID: 79656871
Trimmed Sequence: TTTCCTCTTGAAATATTTCCTCCTCCTGGAAGTCGGACGTTTGGATTCCTTCAGCCGCACCTCGATAGGGAAGTGATCACTCACCTCCAGAGCCTGCTCTTCTGTCAGCCCATAAGCAACCATAAAGTCAAAGACATTGGCAGAGCCTGGTACAATGGAGCTGACCAGCTTCTCACCAACAACGACAATCCTGTCATAGGCACAGTTGGTGCTGGACTTCACTGTCGTATCATTGTTGTCCCCAATCAGCCAAACGAACTCGGTGTGATTCCGGAGACGGATGTTCTTCCAGGATTTCTTGGGCACGTAGGAGCAGCCGGCATTTAGGTCTCCCATGAAAATAAAATTCTCTGAGTTCCATTTCTGTTTGACATCAAGGTCAACATCATAAAGTTCATCGATTTCCCGAACGGCGGCCTCGGGGGTGGTGTGCTGGGGAACGATCACAAACTCTTTGACCTCAGTGCCAGGAGCTTGAAACCAAACCACATAGGGCTCCCGAGAGAAAGCGTCTTCATCTCCCGGCTGCAAGTCTTTATATTGGTACGTTCCTTTAACTGACACCAGGTTCTTCCTGTTTAGTTGTGCCATTAACAATCGGATGACGGTGTTGCTGCTGTCCTTGATTTCCATCAAAAATTGTGATGTCACAGCGGGAAATGATCTTTCTCACTACCTTCATGAAAACCAGGTTTTGTCCCGTTTTGGAATTCCCCCAAGGACTGAACAATTAAAGGGGAACAAAATTCGAAACCCCCCCAAAAAAAGGGGGGGGA
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCCTCTTGAAATATTTCCTCCTCCTGGAAGTCGGACGTTTGGATTCCTTCAGCCGCACCTCGATAGGGAAGTGATCACTCACCTCCAGAGCCTGCTCTTCTGTCAGCCCATAAGCAACCATAAAGTCAAAGACATTGGCAGAGCCTGGTACAATGGAGCTGACCAGCTTCTCACCAACAACGACAATCCTGTCATAGGCACAGTTGGTGCTGGACTTCACTGTCGTATCATTGTTGTCCCCAATCAGCCAAACGAACTCGGTGTGATTCCGGAGACGGATGTTCTTCCAGGATTTCTTGGGCACGTAGGAGCAGCCGGCATTTAGGTCTCCCATGAAAATAAAATTCTCTGAGTTCCATTTCTGTTTGACATCAAGGTCAACATCATAAAGTTCATCGATTTCCCGAACGGCGGCCTCGGGGGTGGTGTGCTGGGGAACGATCACAAACTCTTTGACCTCAGTGCCAGGAGCTTGAAACCAAACCACATAGGGCTCCCGAGAGAAAGCGTCTTCATCTCCCGGCTGCAAGTCTTTATATTGGTACGTTCCTTTAACTGACACCAGGTTCTTCCTGTTTAGTTGTGCCATTAACAATCGGATGACGGTGTTGCTGCTGTCCTTGATTTCCATCAAAAATTGTGATGTCACAGCGGGAAATGATCTTTCTCACTACCTTCATGAAAACCAGGTTTTGTCCCGTTTTGGAATTCCCCCAAGGACTGAACAATTAAAGGGGAACAAAATTCGAAACCCCCCCAAAAAAAGGGGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCCTCTTGAAATATTTCCTCCT