ORFeome > dynlt1 ORF1 – XORFeome v1.0

dynlt1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dynlt1
Gene ID: 866100
Gene Page ID: 491828
ORF Xenbase ID: 17273397

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078505
Original XGC clone length: 117

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ839702
dbEST ID: 79657404
Trimmed Sequence: ATGGATGAATTTCAAACGGCAGAGGAGTCTTCATTTGTTGTGGATGAAATAAGCAACATCATTAAGAGTCAATCGAAAGTGCCATTGGTGGTAATGCCTACCAGCACAACAAAGTT
Full Trace Sequence: GGGTGCTATGGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCNCNNATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGAATTTCAAACGGCAGAGGAGTCTTCATTTGTTGTGGATGAAATAAGCAACATCATTAAGAGTCAATCGAAAGTGCCATTGGTGGTAATGCCTACCAGCACAACAAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCGCCCGAGCGATATCCCGGATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCGTAATAACCTATATGACAAATAAAACCAGATATCAATGATATCATCAGGAGTCCTCGAGACGAGCGAGGACAGAAATGCCTGGACTTCGGTGCTAGCCCGAGGTTGCCGGGTGACGCACACCGGGAAGACGGATGAAGCCGGGAACCGCTTGAACGTAATGCTGTTCGGTTCGTAAGCTGTAATGCGAGTAGCGTCTGCGCGCACGCAACTGGGCAAGAGGCTAGGGCGAATGCAGGGGTGGTAACGGCGCATTGGCGGGTTTTCGTGGTTTGTTAGGACTGTTTTTTTTGGGGGACAATCTATGGCTCGGGGGTCCAAGTAGGAAGCGCCGTAAGCCGGGGGTTGATGTTTGGGGTTAAGGATAAACAAATATGTGAGGAGGAGGGGCGGGCACCCCAAAAAAAAAATAAAAATAAAGGAGGGGAGGGGGGGACGACCCAAAATAATAAACCCAACTTTAAAAAGTTATTGGGGGGTGGCCGGGGGGCACCCCCCAAAAACCACTTTTTATTGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGAATTTCAAACGGCAG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGAACACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTNCNNCNNATTNATAANCAATGCTTTCTTATAATGCCAACTTTNTACAAAAAANTTNNCAACTTTNTTNTACTNNTANNCATTACCACCAATNNCACTTTCNATTNACTCTTAATNATNTTTCTTATTTCATCCACAACAAATAAAAACTCCTCTNCCATTTCAAATTCATCCATNNTCCCAACTTTTTTNTACAAATTTTNCATTATAAAAAANCATTNCTCATCAATTTNTTCCAACAAACANCTCACTATCANTCAAAATAAAATCATTATTTACCATCCAACCTTAATACCCTCCATCNTTTTACAAAATCAAAACTAAAAATTATCAAATAATATAATCTATATCCCTACATCATCAAAACCAAACACTACATACATACCCAAACTCCCCTTCTAACAACTTTTCCATTTATATAACCCCCTAAAAACAACAAAACACACTACTCCTTTTTATATATACTTTATTCAACTTATAACCATCTCTCTCAATCCCCTAACCTCATCCTACACATCATCAATAAACTTCCACTTACCCATTCAATTTTACCTCTCATTAATCTTTTTTCAANATTATTAATCACTNTCTTCTTACACCAAACATTCTACCCCTCCNCCCTTCCTNCAATCTATCTTTTTTCCACAATNTTTCATTTANTCAATTTTCCTCAAACAAAATAAATATTAATAAAAAAAAAAAATCCCCAAAAAAACCAAACTAACACATAATTAAAAAAAAATAATTAACCCCCACCANAAAACAACACTCACCCTATTTAAAATTAATTTNNTCCTTCACACCCCCCCNCCNTTTTACAACACACAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTGTTGTGCTGGTAGGCATT