ORFeome > faah.1 ORF1 – XORFeome v1.0

faah.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: faah.1
Gene ID: 5837114
Gene Page ID: 5837109
ORF Xenbase ID: 17274969

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC129732
Original XGC clone length: 1752

Human orthology & disease relationships

NCBI Entrez ID: 2166
Ensembl gene IDs: ENSG00000117480
Directly associated (OMIM) disease MIM numbers: 606581
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ838926
dbEST ID: 79656628
Trimmed Sequence: ATGATTTTAAAGGCACTTTTGCCCGAAGTGGTGTCAAATCACTTTCTTATATCTGTATTTTGCTGCCTGGTGGGAACATACCTGGTGCTAAGGTTGCTAAATCACAGAGGTGTGAGACAGAAGCTAAGATGTGGGGGAATACAGAGACTCCATTCCTTGGATCTCATGCAGAAGACCGTCTCACAGTTCAAAAAGCAACATCCTGAACTTGATACTGGGCATATTGTTTCCCTGACCCTGTCCCAGTTGGTGGACCAGCTAAAGAAAGGCTCCCTGGCTGCAGAAAGTGTTCTTGTTGCTTATATTGAGAAGGCTTTGGAAGTCAATAAGGAACTAAACTGTCTGACTGACTTTCTGTCTGAGTGTGAGGCCCAACTTCAAGAAGTGAAGAAACAGAAAGAAAAAGGCCTGTTGTATGGAGTGCCGATTACCCTAAAGGACAATGTTGGATATAAGGGCCATGATTCTCACTGCGGACTTGTACAATTCCTTGGTATCGCGGACCAAGAGGACAGTGTGATTGTGCAGGTTTTAAAGAAGCATGGGGCTGTTCCCTTCGTGAAGACCAATATACCACAATCCATGATAAATTTTGACTGCAGCAATTCCATCTTTGGACAAACTTTAAATCCTCATAATCACAAAAAAACAATGTGGAGGGTTCCAGGCGGTGGGGGAAGCAGCTCTGATCGCAGAAAGGAGGGGCAGTACTCGGCGTTAGGTACGAATGTTCCTTGGAAGTATCAGAATGCCTTTTCAACTTTTTGTTGAAATATTTTGCCCTTAAACATACAAGGGATCCCAATTTAAATTTCCTTTGGAATTTTTCTTAACCCCT
Full Trace Sequence: CGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTTTAAAGGCACTTTTGCCCGAAGTGGTGTCAAATCACTTTCTTATATCTGTATTTTGCTGCCTGGTGGGAACATACCTGGTGCTAAGGTTGCTAAATCACAGAGGTGTGAGACAGAAGCTAAGATGTGGGGGAATACAGAGACTCCATTCCTTGGATCTCATGCAGAAGACCGTCTCACAGTTCAAAAAGCAACATCCTGAACTTGATACTGGGCATATTGTTTCCCTGACCCTGTCCCAGTTGGTGGACCAGCTAAAGAAAGGCTCCCTGGCTGCAGAAAGTGTTCTTGTTGCTTATATTGAGAAGGCTTTGGAAGTCAATAAGGAACTAAACTGTCTGACTGACTTTCTGTCTGAGTGTGAGGCCCAACTTCAAGAAGTGAAGAAACAGAAAGAAAAAGGCCTGTTGTATGGAGTGCCGATTACCCTAAAGGACAATGTTGGATATAAGGGCCATGATTCTCACTGCGGACTTGTACAATTCCTTGGTATCGCGGACCAAGAGGACAGTGTGATTGTGCAGGTTTTAAAGAAGCATGGGGCTGTTCCCTTCGTGAAGACCAATATACCACAATCCATGATAAATTTTGACTGCAGCAATTCCATCTTTGGACAAACTTTAAATCCTCATAATCACAAAAAAACAATGTGGAGGGTTCCAGGCGGTGGGGGAAGCAGCTCTGATCGCAGAAAGGAGGGGCAGTACTCGGCGTTAGGTACGAATGTTCCTTGGAAGTATCAGAATGCCTTTTCAACTTTTTGTTGAAATATTTTGCCCTTAAACATACAAGGGATCCCAATTTAAATTTCCTTTGGAATTTTTCTTAACCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTTTAAAGGCACTTTTGCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838925
dbEST ID: 79656627
Trimmed Sequence: CTTGTTTAATTTTCCACGAGTTACATTTTCTACTTCCTTCATAAGTCGAAGACACTGTTCTTCTTGCCAGGGTAATGCCACACACTGCACAGCCAACGGAAGCCCAACACCATCTTCCATGCCCTTAATAACATCTTTGTCCCAAAGATCATTATAGTATCCTTTGTAATTCTTCAGTTCTTCCTCGTCTTCGGGTGTAACAATGTTAACAGGTAGAACCCCAGCAGGAAAGTTCAAAATATTGAATAGCATGGTGAAGCAAAAGCCAGCAAAGAGTTTTCCAGGACATCCAATATTAAAAGCTGGACCCAACATAGGGCAGAGCAAGGCATCCAAATTCAGCTTTTTCCATTCGTTAATATATTCACAGCGGTACTCCTTTATTGCTGCATTATGTTTCCACAATTGTTTGACTGAGCCCACACCACAGTGTGCATTCACATGGTTTGCAATGCGTGGAAATACTGGCCTCATGAAAAAGGTTATGATCTTCTTCACAATGGTGGGTATTTTATACAGAAGCATCTGTTGTTTCAGGTTAGGATCCACTATGTCTGCATTGAATTTATCTACTAAAGTGGATCCTCCATCTGCAAAAAACCCTCTATACAAAGCTCATTGAGTGCATATTCTATGCGTGGTGGAAAAAAAGGAACCACCTTGTGACCTGCTTCCTCCACCAAAACCTTTGGTTTTCTGGAAATGCCCTTCTCAATACCAGGGGAAAGGGTAAAAAAAAAACCCCTTCTGGGGTCCAAAAAA
Full Trace Sequence: GGGTAAAAGGCTATAGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTGTTTAATTTTCCACGAGTTACATTTTCTACTTCCTTCATAAGTCGAAGACACTGTTCTTCTTGCCAGGGTAATGCCACACACTGCACAGCCAACGGAAGCCCAACACCATCTTCCATGCCCTTAATAACATCTTTGTCCCAAAGATCATTATAGTATCCTTTGTAATTCTTCAGTTCTTCCTCGTCTTCGGGTGTAACAATGTTAACAGGTAGAACCCCAGCAGGAAAGTTCAAAATATTGAATAGCATGGTGAAGCAAAAGCCAGCAAAGAGTTTTCCAGGACATCCAATATTAAAAGCTGGACCCAACATAGGGCAGAGCAAGGCATCCAAATTCAGCTTTTTCCATTCGTTAATATATTCACAGCGGTACTCCTTTATTGCTGCATTATGTTTCCACAATTGTTTGACTGAGCCCACACCACAGTGTGCATTCACATGGTTTGCAATGCGTGGAAATACTGGCCTCATGAAAAAGGTTATGATCTTCTTCACAATGGTGGGTATTTTATACAGAAGCATCTGTTGTTTCAGGTTAGGATCCACTATGTCTGCATTGAATTTATCTACTAAAGTGGATCCTCCATCTGCAAAAAACCCTCTATACAAAGCTCATTGAGTGCATATTCTATGCGTGGTGGAAAAAAAGGAACCACCTTGTGACCTGCTTCCTCCACCAAAACCTTTGGTTTTCTGGAAATGCCCTTCTCAATACCAGGGGAAAGGGTAAAAAAAAAACCCCTTCTGGGGTCCAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGTTTAATTTTCCACGAGTTAC