ORFeome > fam26f ORF1 – XORFeome v1.0

fam26f ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fam26f
Gene ID: 991403
Gene Page ID: 991399
ORF Xenbase ID: 17275311

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC131889
Original XGC clone length: 753

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ838591
dbEST ID: 79656293
Trimmed Sequence: ATGCTGAATTTTCCCTTGTGGAAACACATGACCGGTTGCTGCAACTCTGAAAAACCACGCCACCATGTTTGTCGAAGATGGGTACTTTTCTTTCGGGTGTTTTGGCAAATGACTTTTGTATCGGCTTTAGCTCCTCTGATCTGGATTGCTCTGGCACTGCTGAATGGCACTTTCTATGTCTGTATAGTGTCAGGCCTGAAATTGGAGCATGTATGTGACCACAAAGAAAAATGTATAAAGGAATTACCCCACATTCCCTGTCCTAAGTTGATCACCTCAAACCTTTCCAGGGCGGAGATAACTCAGGTGGCAAGCTTTATGAGGGCCGAATCACAGATTCTGGGCTGGACAGTGTTAGGCTGTGTTTTGATTGTAGTGGTGCTTTCTACTTGCATACGTCGATGTATATCCCCTGTCAGCTACCTCCAGCTGAAGTTCTGGAAAATGTATATAGAAAGGGAACAAGAACTGTTCGATGTAAAGTGTAAGGAGCATGCCACTAAACTTGCTGAGAGGAACATCAGCATCTTCTTTGATCATACTAAAGTAGAAAAATTCCAGACACCCAAAAACAACAACTGGAACCAGATCTCCTCCGCCTACATCTTTAAAAAAAAAACACAGTTTTAAGTATGTTTCACCGATTTGTTGAGTATCAGAATGGAAAAAAACTTAATTTTCCAAAAAGTGAAATTGGTTTCCCCGCTTAAATAGCCCAGGTAAAATATAATTATGGCTTTTAAAGGTTTGCACCTTTTCTGGTAAAAAATTGTCCGTTAATAAAAAAAACAATTTTCTTTAACAATTTTTTTT
Full Trace Sequence: TCGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGAATTTTCCCTTGTGGAAACACATGACCGGTTGCTGCAACTCTGAAAAACCACGCCACCATGTTTGTCGAAGATGGGTACTTTTCTTTCGGGTGTTTTGGCAAATGACTTTTGTATCGGCTTTAGCTCCTCTGATCTGGATTGCTCTGGCACTGCTGAATGGCACTTTCTATGTCTGTATAGTGTCAGGCCTGAAATTGGAGCATGTATGTGACCACAAAGAAAAATGTATAAAGGAATTACCCCACATTCCCTGTCCTAAGTTGATCACCTCAAACCTTTCCAGGGCGGAGATAACTCAGGTGGCAAGCTTTATGAGGGCCGAATCACAGATTCTGGGCTGGACAGTGTTAGGCTGTGTTTTGATTGTAGTGGTGCTTTCTACTTGCATACGTCGATGTATATCCCCTGTCAGCTACCTCCAGCTGAAGTTCTGGAAAATGTATATAGAAAGGGAACAAGAACTGTTCGATGTAAAGTGTAAGGAGCATGCCACTAAACTTGCTGAGAGGAACATCAGCATCTTCTTTGATCATACTAAAGTAGAAAAATTCCAGACACCCAAAAACAACAACTGGAACCAGATCTCCTCCGCCTACATCTTTAAAAAAAAAACACAGTTTTAAGTATGTTTCACCGATTTGTTGAGTATCAGAATGGAAAAAAACTTAATTTTCCAAAAAGTGAAATTGGTTTCCCCGCTTAAATAGCCCAGGTAAAATATAATTATGGCTTTTAAAGGTTTGCACCTTTTCTGGTAAAAAATTGTCCGTTAATAAAAAAAACAATTTTCTTTAACAATTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGAATTTTCCCTTGTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838590
dbEST ID: 79656292
Trimmed Sequence: ACTTTCAAAGCCATCAATCATATCTACCATGGGCATCTCAGCTGGAGAAACCATATCACCTTCTAGTGAAATTAAGCTTTTTTTCCTATCTGGATACTCCACAAATCGGTGTAACATACTGTAAAACTGTGTCTTCTTGTTAAAGATGTAGGCCGAGGAGATCTGGTTCCAGTCGTTGTTTTTTGGTGTCTCGAATTGTTCTACTTTAGTATGATCAAAGAAGATGCTGATGTTCCTCTCAGCAAGTTTAGTGGCATGCTCCTTACACTTTACATCGAACAGTTCTTGTTCCCTTTCTATATACATTTTCCAGAACTTCAGCTGGAGGTAGCTGACAGGGGATATACATCGACGTATGCAAGTAGAAAGCACCACTACAATCAAAACACAGCCTAACACTGTCCAGCCCAGAATCTGTGATTCGGCCCTCATAAAACTTGCCACCTGAGTTATCTCCGCCCTGCAAAGGTTTGAGGTGATCGACTTATGACAGGGAATGTGGGGGTAGTTCCTTTATACATTTTTCTTTTTGGTCGCGTACGTGCTCCAGTTTTCAGCCCGACGGTAAAACAACAAAAAGAGTTCCCTTCTGCAGTTGCCGAAGCAATCCGAATCAAAGAAACTGAGGCCGAAAACAAAGTATATTTGCGAAAAAACCCGAAAAAAAAATAACCAATCTTCCAAAAACCATGCGGGCGGGGGGGTGGGGGGGGGTGCCGCCAGCCGGGTGGGGCGGTTGGCGGGAAAGGAAAAATATTAACAAAAAGGATAC
Full Trace Sequence: GGCAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTTTCAAAGCCATCAATCATATCTACCATGGGCATCTCAGCTGGAGAAACCATATCACCTTCTAGTGAAATTAAGCTTTTTTTCCTATCTGGATACTCCACAAATCGGTGTAACATACTGTAAAACTGTGTCTTCTTGTTAAAGATGTAGGCCGAGGAGATCTGGTTCCAGTCGTTGTTTTTTGGTGTCTCGAATTGTTCTACTTTAGTATGATCAAAGAAGATGCTGATGTTCCTCTCAGCAAGTTTAGTGGCATGCTCCTTACACTTTACATCGAACAGTTCTTGTTCCCTTTCTATATACATTTTCCAGAACTTCAGCTGGAGGTAGCTGACAGGGGATATACATCGACGTATGCAAGTAGAAAGCACCACTACAATCAAAACACAGCCTAACACTGTCCAGCCCAGAATCTGTGATTCGGCCCTCATAAAACTTGCCACCTGAGTTATCTCCGCCCTGCAAAGGTTTGAGGTGATCGACTTATGACAGGGAATGTGGGGGTAGTTCCTTTATACATTTTTCTTTTTGGTCGCGTACGTGCTCCAGTTTTCAGCCCGACGGTAAAACAACAAAAAGAGTTCCCTTCTGCAGTTGCCGAAGCAATCCGAATCAAAGAAACTGAGGCCGAAAACAAAGTATATTTGCGAAAAAACCCGAAAAAAAAATAACCAATCTTCCAAAAACCATGCGGGCGGGGGGGTGGGGGGGGGTGCCGCCAGCCGGGTGGGGCGGTTGGCGGGAAAGGAAAAATATTAACAAAAAGGATAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTTTCAAAGCCATCAATCATATC