ORFeome > gstk1 ORF1 – XORFeome v1.0

gstk1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: gstk1
Gene ID: 5903743
Gene Page ID: 5903716
ORF Xenbase ID: 17278095

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054290
Original XGC clone length: 570

Human orthology & disease relationships

NCBI Entrez ID: 373156
Ensembl gene IDs: ENSG00000197448
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 215600,230450,231900,266130,607748

Library Location

Plate ID: GDExl11002
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ839321
dbEST ID: 79657023
Trimmed Sequence: ATGTCTAAGCGCAGGGTGCTGGAGTGTTTCTATGATGTGGTCTCCCCATACTCGTGGCTGGGGTTTGAGGTCGTGTGCCGATACAAAAACATCTGGAATGTAGACGTCCGTTTGCGCCCGGGGTTTCTTGGTGGAATCATGCAAGCGACAGGTAACTCTCCCCCTGCGATGGTGCCAAAGAAAGGCATGTATATGGGAAAGGATATAGCCAGACTCGCTGAATTCTTCCAAGTTCCTCTCCAACAGCCCAGGGATTTCTTCCAGACTGTCATTAAGAAAGGAAGCCTCCAAGCAATGCGGTTTGTCACGGCCGTAGAGATGCATCACCCAGAATTTGTGGAGCCGGTGTCTCGGGAGCTGTGGATGCGGATCTGGTCAGAGGACAAAGATATCACAGAGCCAGAGAGTATCCTAGAAGCGGCCAAGAAAGCCGGGATGTCAGCAGATCTGGCAAAGAAGCTGATTGAGTCTTCGGCCCTTCCAGAAGTGAAGAACAAGCTGAAGCAAAATACTGAAGAAGCCTTAAAATATGGGGTGATTTCACCTGTTGCTAAATCCTGTTCATCATT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTAAGCGCAGGGTGCTGGAGTGTTTCTATGATGTGGTCTCCCCATACTCGTGGCTGGGGTTTGAGGTCGTGTGCCGATACAAAAACATCTGGAATGTAGACGTCCGTTTGCGCCCGGGGTTTCTTGGTGGAATCATGCAAGCGACAGGTAACTCTCCCCCTGCGATGGTGCCAAAGAAAGGCATGTATATGGGAAAGGATATAGCCAGACTCGCTGAATTCTTCCAAGTTCCTCTCCAACAGCCCAGGGATTTCTTCCAGACTGTCATTAAGAAAGGAAGCCTCCAAGCAATGCGGTTTGTCACGGCCGTAGAGATGCATCACCCAGAATTTGTGGAGCCGGTGTCTCGGGAGCTGTGGATGCGGATCTGGTCAGAGGACAAAGATATCACAGAGCCAGAGAGTATCCTAGAAGCGGCCAAGAAAGCCGGGATGTCAGCAGATCTGGCAAAGAAGCTGATTGAGTCTTCGGCCCTTCCAGAAGTGAAGAACAAGCTGAAGCAAAATACTGAAGAAGCCTTAAAATATGGGGTGATTTCACCTGTTGCTAAATCCTGTTCATCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCCATTCCACTAATATCCCCCTAAGTGAGTCTTATACATGGGTTCCTTAGCAAAAAAAAAAAAAAAAAAAAAACCGAGTTCTCAAAAACCTCTCTGAAATTTTAAAAAAAGCGCCCCNAAAAAAACAAACCCCTTCCTCCCCTCTCCCGCCCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTAAGCGCAGGGTGCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839320
dbEST ID: 79657022
Trimmed Sequence: TGATGAACAGGATTTAGCAACAGGTGAAATCACCCCATATTTTAAGGCTTCTTCAGTATTTTGCTTCAGCTTGTTCTTCACTTCTGGAAGGGCCGAAGACTCAATCAGCTTCTTTGCCAGATCTGCTGACATCCCGGCTTTCTTGGCCGCTTCTAGGATACTCTCTGGCTCTGTGATATCTTTGTCCTCTGACCAGATCCGCATCCACAGCTCCCGAGACACCGGCTCCACAAATTCTGGGTGATGCATCTCTACGGCCGTGACAAACCGCATTGCTTGGAGGCTTCCTTTCTTAATGACAGTCTGGAAGAAATCCCTGGGCTGTTGGAGAGGAACTTGGAAGAATTCAGCGAGTCTGGCTATATCCTTTCCCATATACATGCCTTTCTTTGGCACCATCGCAGGGGGAGAGTTACCTGTCGCTTGCATGATTCCACCAAGAAACCCCGGGCGCAAACGGACGTCTACATTCCAGATGTTTTTGTATCGGCACACGACCTCAAACCCCAGCCACGAGTATGGGGAGACCACATCATAGAAACACTCCAGCACCCTGCGCTTAAACATGGTGCCCACTTTTTTGGAACAAGTTTGGATTATAAAAAAGCATTTGCCCTCCATTTGTTGCAACAACAGGGTACTATCATTCAAAATTAAATCAATAATTGGGGAAAAAAACCAAATACTGCCCGTCTTTTATTGTTCCGTTGTGGAAGGGGGGAGTTTTCCGGGGCCGCCCCTTTGCCCCCTTTTTCTCTAAAATTTTTCTT
Full Trace Sequence: GAGAAACAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGATGAACAGGATTTAGCAACAGGTGAAATCACCCCATATTTTAAGGCTTCTTCAGTATTTTGCTTCAGCTTGTTCTTCACTTCTGGAAGGGCCGAAGACTCAATCAGCTTCTTTGCCAGATCTGCTGACATCCCGGCTTTCTTGGCCGCTTCTAGGATACTCTCTGGCTCTGTGATATCTTTGTCCTCTGACCAGATCCGCATCCACAGCTCCCGAGACACCGGCTCCACAAATTCTGGGTGATGCATCTCTACGGCCGTGACAAACCGCATTGCTTGGAGGCTTCCTTTCTTAATGACAGTCTGGAAGAAATCCCTGGGCTGTTGGAGAGGAACTTGGAAGAATTCAGCGAGTCTGGCTATATCCTTTCCCATATACATGCCTTTCTTTGGCACCATCGCAGGGGGAGAGTTACCTGTCGCTTGCATGATTCCACCAAGAAACCCCGGGCGCAAACGGACGTCTACATTCCAGATGTTTTTGTATCGGCACACGACCTCAAACCCCAGCCACGAGTATGGGGAGACCACATCATAGAAACACTCCAGCACCCTGCGCTTAAACATGGTGCCCACTTTTTTGGAACAAGTTTGGATTATAAAAAAGCATTTGCCCTCCATTTGTTGCAACAACAGGGTACTATCATTCAAAATTAAATCAATAATTGGGGAAAAAAACCAAATACTGCCCGTCTTTTATTGTTCCGTTGTGGAAGGGGGGAGTTTTCCGGGGCCGCCCCTTTGCCCCCTTTTTCTCTAAAATTTTTCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGATGAACAGGATTTAGCAACAG