ORFeome > hnrnpa0 ORF2 – XORFeome v1.0

hnrnpa0 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hnrnpa0
Gene ID: 1000580
Gene Page ID: 1000572
ORF Xenbase ID: 17279289

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106305
Original XGC clone length: 927

Human orthology & disease relationships

NCBI Entrez ID: 10949
Ensembl gene IDs: ENSG00000177733
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11087
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ837986
dbEST ID: 79655688
Trimmed Sequence: ATGAGTAGCGGCGACATGGATACCACGCAGCTGTGCAAGTTGTTTATCGGAGGCCTGAACGTGCAGACCACAGAAGAGGGCCTACGGCAGCACTTCGAGACCTACGGGCAATTGACGGATTGCGTTGTGGTGATCAACCCACAGACCAAGCGCTCTCGCTGTTTCGGTTTCGTAACCTACTCGAGCGCTGCAGAAGCTGACGCAGCTGTGGAGGCCTCGCCGCACGTGGTTGATGGGAACAACGTTGAACTAAAGCGGGCCGTATCCAGGGAAGATTCCGCCAGGCCGGGGGCGCACGCTAAAGTGAAAAAGCTCTTTGTTGGCGGCCTGAAAGAAGAGGTCGGCGAGAGTGATTTGCTCGAGCACTTCTCCCAGTTCGGCCCCGTGGAGAAAGTAGAGGTCATCGCCGATAAATTGACCGGCAAGAAACGCGGCTTCGGCTTTGTCTACTTCAACAGCCACGACTCCGCCGACAAGGCCGCGGTGGTCAAGTTCCACTCCGTCAACGGGCACCGCGTGGAGGTAAGAAAGGCCGTCCCTAAAGAAGAACTTTCTCACGGTTCCGACAGATCCTTCCGCGGTGGCAGAGGCGGGAAAAGCCGTGGCGGCGGCGGACCCCCCCCAAATTACAATGTTATATCCGGGAGTTGGCGGCAACCCTGCCTTTTGGCGGAGGGTATGGGGGCCGCCGCCTCCTGCCCCACTTTTCTGTACCAAGTTTGCATTTATAAAAAGCCATTGCTTTAAATTTTGTTGGAAAAAAACAGGGTAACAAAAAAAGAAAAAAAAAAAAATCATTAAATTTCCGCAACCCGCACCCT
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTAGCGGCGACATGGATACCACGCAGCTGTGCAAGTTGTTTATCGGAGGCCTGAACGTGCAGACCACAGAAGAGGGCCTACGGCAGCACTTCGAGACCTACGGGCAATTGACGGATTGCGTTGTGGTGATCAACCCACAGACCAAGCGCTCTCGCTGTTTCGGTTTCGTAACCTACTCGAGCGCTGCAGAAGCTGACGCAGCTGTGGAGGCCTCGCCGCACGTGGTTGATGGGAACAACGTTGAACTAAAGCGGGCCGTATCCAGGGAAGATTCCGCCAGGCCGGGGGCGCACGCTAAAGTGAAAAAGCTCTTTGTTGGCGGCCTGAAAGAAGAGGTCGGCGAGAGTGATTTGCTCGAGCACTTCTCCCAGTTCGGCCCCGTGGAGAAAGTAGAGGTCATCGCCGATAAATTGACCGGCAAGAAACGCGGCTTCGGCTTTGTCTACTTCAACAGCCACGACTCCGCCGACAAGGCCGCGGTGGTCAAGTTCCACTCCGTCAACGGGCACCGCGTGGAGGTAAGAAAGGCCGTCCCTAAAGAAGAACTTTCTCACGGTTCCGACAGATCCTTCCGCGGTGGCAGAGGCGGGAAAAGCCGTGGCGGCGGCGGACCCCCCCCAAATTACAATGTTATATCCGGGAGTTGGCGGCAACCCTGCCTTTTGGCGGAGGGTATGGGGGCCGCCGCCTCCTGCCCCACTTTTCTGTACCAAGTTTGCATTTATAAAAAGCCATTGCTTTAAATTTTGTTGGAAAAAAACAGGGTAACAAAAAAAGAAAAAAAAAAAAATCATTAAATTTCCGCAACCCGCACCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTAGCGGCGACATGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837985
dbEST ID: 79655687
Trimmed Sequence: GAAGGAGCCGCCGCCATAACCTCCGCCAAAAGCAGGATTGCCGCCACTGCCGGATATACCATTGTAATCTCGGGGGGGTCCGCCGCCGCCACGGCCTCTCCCGCCTCTGCCACCGCGGAAGGATCTGTTGGAACCCTGAGAAAGTTCTTCTTTAGGGACGGCCTTTTTTACCTCCACGCGGTGCCCGTTGACGGAGTGGAACTTGACCACCGCGGCCTTGTCGGCGGAGTCCTGGCTGTTGAAGTAGACAAAGCCGAAGCCGCGTTTCTTGCCGGTCAATTTATCGGCGATGACCTCTACTTTCTCCACTGGGCCGAACTGGGAGAAGAGCTCCAGCAGATCAGTCTCGCCGACCTCTTCTTTCATGCCTCCAGACGGGAGAATTTTCACTTTATGGTGCGCGCCCGACCAGGCGGAATCAGCTCTAAAGGGGGCCCGGGTGGGTTCTGCTTCGTTCCCACCAAGCGCAGGCGCGGGGAGGGGACGGGGCTGCGTCATCTTCTCCTAGCGCTAAGTAGGTTAAGGAAAGGAAGCGGAAAGGACGCTGGGTGTGGGGTGTGGGGGGCGCGGCCCACACCGCTCATCTACCGTGGGGGCGGGGGGGGGAGCGCGCCCCGGCAAGCTTCGGGGGGGGGGGGGGGGGCGCCCCGCGGGGGGCATGGCCAGCGGGGGTGGGATGCGGAGAGCACCCACGCCGGCGCCTCCGCCAAGGGGGTGAAAAAAAAAAGAGGGAGAGTGGGGGGGNNTTTNTGAGAAAAAAAAAAAAAAAAAAAAAAGAA
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGGAGCCGCCGCCATAACCTCCGCCAAAAGCAGGATTGCCGCCACTGCCGGATATACCATTGTAATCTCGGGGGGGTCCGCCGCCGCCACGGCCTCTCCCGCCTCTGCCACCGCGGAAGGATCTGTTGGAACCCTGAGAAAGTTCTTCTTTAGGGACGGCCTTTTTTACCTCCACGCGGTGCCCGTTGACGGAGTGGAACTTGACCACCGCGGCCTTGTCGGCGGAGTCCTGGCTGTTGAAGTAGACAAAGCCGAAGCCGCGTTTCTTGCCGGTCAATTTATCGGCGATGACCTCTACTTTCTCCACTGGGCCGAACTGGGAGAAGAGCTCCAGCAGATCAGTCTCGCCGACCTCTTCTTTCATGCCTCCAGACGGGAGAATTTTCACTTTATGGTGCGCGCCCGACCAGGCGGAATCAGCTCTAAAGGGGGCCCGGGTGGGTTCTGCTTCGTTCCCACCAAGCGCAGGCGCGGGGAGGGGACGGGGCTGCGTCATCTTCTCCTAGCGCTAAGTAGGTTAAGGAAAGGAAGCGGAAAGGACGCTGGGTGTGGGGTGTGGGGGGCGCGGCCCACACCGCTCATCTACCGTGGGGGCGGGGGGGGGAGCGCGCCCCGGCAAGCTTCGGGGGGGGGGGGGGGGGCGCCCCGCGGGGGGCATGGCCAGCGGGGGTGGGATGCGGAGAGCACCCACGCCGGCGCCTCCGCCAAGGGGGTGAAAAAAAAAAGAGGGAGAGTGGGGGGGNNTTTNTGAGAAAAAAAAAAAAAAAAAAAAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGGAGCCGCCGCCATAA