ORFeome > itpk1 ORF1 – XORFeome v1.0

itpk1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: itpk1
Gene ID: 950622
Gene Page ID: 950615
ORF Xenbase ID: 17280801

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054977
Original XGC clone length: 1191

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ839447
dbEST ID: 79657149
Trimmed Sequence: ATGCAGACTTTCCTCAAAGGGAAGAGGGTGGGTTACTGGATGAGCGAGAAAAAGATCAAGAAACTGAATTTTCAGGCTTTCGCAGATTTGTGCAGGAAAAGAGGCATTGAGGTCGTACAGCTTAATCTGGCCAAACCCATTGAGGACCAGGGCCCTCTAGATGTGATTATACACAAACTGACAGATGTCATTCTTGAGGCTGACCAAAAAGATAGCGAGTCCATGCAGCTGGTGCAAAGGTTCCAGGACTATATTGAAGCTCACCCTGAAACAATAATACTTGACCCATTGCCTGCCATTAGAACATTGCTGGACCGCTCAAAATCTTACGAGCTTATTCGCAGAATAGAGACCTACATGCAAGATGAAAGGATTTGCTCCCCTCCATTCATGGAGCTAATGGCAGAATGTGATGAAGATACCTTGAAGATTTTAGAGAAAAATGGCCTGGCATTTCCATTAGTTTGTAAGACTCGAGTGGCCCATGGTACAAACTCTCATGAGATGGCGATTATATTTAATCCAGAAGGACTGTGGTCAATCAAGCCTCCCTGTGTAATTCAAAGCTTCATTAGCCACAATGCGGTCCTCTACAAAGTCTTTGTGGGTGGGAGAATCTTATACAGTAGTAGAGCGACCATCCTTGAAAAACTTCTCACTTGGAGCTTCTGACAGAGCATCCATATTCTTCAACAGTCACAATGTTTTCAAACCCTGAATCCTCCTCGGTTCTAACAGCACCTGGAAAAAGGTGAAAGGCGTATTTGAACGAACCCCTGTTGAAGAAAATTAATTCCGGGGGGAATCCCCA
Full Trace Sequence: TCGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGACTTTCCTCAAAGGGAAGAGGGTGGGTTACTGGATGAGCGAGAAAAAGATCAAGAAACTGAATTTTCAGGCTTTCGCAGATTTGTGCAGGAAAAGAGGCATTGAGGTCGTACAGCTTAATCTGGCCAAACCCATTGAGGACCAGGGCCCTCTAGATGTGATTATACACAAACTGACAGATGTCATTCTTGAGGCTGACCAAAAAGATAGCGAGTCCATGCAGCTGGTGCAAAGGTTCCAGGACTATATTGAAGCTCACCCTGAAACAATAATACTTGACCCATTGCCTGCCATTAGAACATTGCTGGACCGCTCAAAATCTTACGAGCTTATTCGCAGAATAGAGACCTACATGCAAGATGAAAGGATTTGCTCCCCTCCATTCATGGAGCTAATGGCAGAATGTGATGAAGATACCTTGAAGATTTTAGAGAAAAATGGCCTGGCATTTCCATTAGTTTGTAAGACTCGAGTGGCCCATGGTACAAACTCTCATGAGATGGCGATTATATTTAATCCAGAAGGACTGTGGTCAATCAAGCCTCCCTGTGTAATTCAAAGCTTCATTAGCCACAATGCGGTCCTCTACAAAGTCTTTGTGGGTGGGAGAATCTTATACAGTAGTAGAGCGACCATCCTTGAAAAACTTCTCACTTGGAGCTTCTGACAGAGCATCCATATTCTTCAACAGTCACAATGTTTTCAAACCCTGAATCCTCCTCGGTTCTAACAGCACCTGGAAAAAGGTGAAAGGCGTATTTGAACGAACCCCTGTTGAAGAAAATTAATTCCGGGGGGAATCCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGACTTTCCTCAAAGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839446
dbEST ID: 79657148
Trimmed Sequence: TTGGGAGGAAGCCTTGGTTGCCAAAGAGGCCACACAGTGCTGCTGGAAGCTGGGAGAAACTGATGAATTGCATCCTAGTCTCTGACTTTGCAACTTTACAGATCCACTTGTGTCTGTCTCCACAATCCATGGGTCTGTTCGAGCAGGTGGAGTACAGCAAAGGCGCTCTCCAAGTGAACTTCCTGTCTGCTCCACTGAGGACTTGTTTGCACTCTGATCTGGACGTTGCAAAATGGTTGTAATGTGGTTCAGGAGGTCAGTGAAGAATTCTGGGACACCCTCATAGCCTGGGAAAGCATTGATATCAATCACAGCATGTTGGCCAGTCTTGTTGTTTATAATGATATCAATGCCAAAAAGAGAGATTCCCAAAGCCTGACGTAGTGCTTTGGAGATCCCACGAATAACTTCATCACAGGGTCGCTCAAATACGCCTTCAACCTTTTCAAGTGCTGTTAGAACAGAGGATGATTCAGGCTTTGAAACATTGTGACTGTTGAAGAATATGGATGCTCTGTCAGAAGCTCCAAGTGAGAAGTTTTTCAAGGATGGTCGCTCTACTACTGTATAAGATTCTCCCACCACAAAGACTTTGTAAAGGACCGCAATGTGGCTTATGAAGCTTTGAATTACACAAGGAAGGCTTGATTGGACACAGTCCTTTCTGGATTAAATATATCCGC
Full Trace Sequence: AGAGGGCTATTGACCATGGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGGGAGGAAGCCTTGGTTGCCAAAGAGGCCACACAGTGCTGCTGGAAGCTGGGAGAAACTGATGAATTGCATCCTAGTCTCTGACTTTGCAACTTTACAGATCCACTTGTGTCTGTCTCCACAATCCATGGGTCTGTTCGAGCAGGTGGAGTACAGCAAAGGCGCTCTCCAAGTGAACTTCCTGTCTGCTCCACTGAGGACTTGTTTGCACTCTGATCTGGACGTTGCAAAATGGTTGTAATGTGGTTCAGGAGGTCAGTGAAGAATTCTGGGACACCCTCATAGCCTGGGAAAGCATTGATATCAATCACAGCATGTTGGCCAGTCTTGTTGTTTATAATGATATCAATGCCAAAAAGAGAGATTCCCAAAGCCTGACGTAGTGCTTTGGAGATCCCACGAATAACTTCATCACAGGGTCGCTCAAATACGCCTTCAACCTTTTCAAGTGCTGTTAGAACAGAGGATGATTCAGGCTTTGAAACATTGTGACTGTTGAAGAATATGGATGCTCTGTCAGAAGCTCCAAGTGAGAAGTTTTTCAAGGATGGTCGCTCTACTACTGTATAAGATTCTCCCACCACAAAGACTTTGTAAAGGACCGCAATGTGGCTTATGAAGCTTTGAATTACACAAGGAAGGCTTGATTGGACACAGTCCTTTCTGGATTAAATATATCCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGGAGGAAGCCTTGGT