ORFeome > lmnb1 ORF1 – XORFeome v1.0

lmnb1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lmnb1
Gene ID: 489662
Gene Page ID: 489657
ORF Xenbase ID: 17282265

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041185
Original XGC clone length: 1755

Human orthology & disease relationships

NCBI Entrez ID: 4001
Ensembl gene IDs: ENSG00000113368
Directly associated (OMIM) disease MIM numbers: 169500
Indirectly associated (Lage, et al.) disease MIM numbers: 115200,121850,137800,151660,153480,158350,159001,176670,176807,176920,181350,248370,276950,300555,309000,604929,605588,607920,608056,608089

Library Location

Plate ID: GDExl11008
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GACAAATTAGATTTTATTTTGACTGATATTAGCCGGTCCGTGGACCAAATTGTTGACAAGGGCTTTTTTTATGGCCGATTTTTTACAAAAAATTTGGCCCTGGCGGAGCGCGTATGTCTGCATGCCCTTTATGAGGCAGCTGGGGCGAAAAAAGAGAGGGAAAAGAAGGGCACGCGTTATTTCTTTACATCTGCGGAGTGTTTGAAAACCTCGTGACCGTGCACCGCAAATTTGACGAACTGGTTTCTGTTACCCTCAGGGTGAAGTCAACTGGGAGTCAAAATGTGTGCTTGGGTGTCTCGGCACACCGGCAAGATTGCGCTGTGGAGCAGGCTACTGCTGTGCCTCTTGTCGAGGTGTAAGGGCTTCCGAAACATTACTAAAGGGGGAGGGTGGTCCCTACCCGGTCTTGGCCGACGAGTCTGTGAGCAGCTCCGAAATCTCTGGTTGGAGCATCTGGGTCCCCTGGTAGTACCCGCACAGTATGAAGCTCAGTTGCTCGCGTCGCTGCACACCCCTAAAGAGAGAGCGAGCTCCAAAAGTGGATAGAATGGATACATTTGTAACTGTCCATATGAAATATATCCCTTGGCAGATTGTCGTGAGGAGAAGACAGAGGCAAAGGAGAGCACGAGCTCGATTCGCGCCTCCCTCCAACAAACATTTTCTTTTATTATTTTTTTTATAAGTAGGGCTGGAAATGTGCGTGGTTCCCTTCATTCAGGGGCCATCCGGTCTGGGGGGGGGGGGGGTACTTGATACAAAAACTGCACCAATCTCCCCCAACAAAAAAAGCATTGGGTGGGGATTTGTTTCCGCGGGGGAGGGAAAGTGAGAAAAAAAAAAAAAAAATGATTTAACAAACCGGGGGGAGGGGGGGCGGGGGGGGAATTTGAAATATTTTTTTTCTCCCCACCTCTCCCCCCGAGAACGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACCGCCACACCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ828935
dbEST ID: 79646637
Trimmed Sequence: CATGATGGCGCAGTTTTTATTTCCAGACTTCTGCTGAGAGTAGAGAGATTCTTTAGCAGTCTCCTCAAATATTTCTTCTTCCTCCTCCAACTCCTCTTCAGGTATATTGGTGGTGTACACGGTTGTGCGCTGTGCTACTTCCTCTCCCTGAGAATTCTTCAGTGTGGCCTTCACATCTTCTCCTGTTCCCCATGAATTCTGGTTCTTCCAGATTAGGTCAGATGGTGGACTTGCTGTAACTCCAGCATCAGCAGCCCAGATTGTGACAGTCTGTCCTGCTTTAAGTACGTATCTTGAGGTAAACTTGAAATTCACAGACGCTTCTCCAATTGTTCTGGTGAGTTCCCAACCCCCCAAAGGCTGATCCTTCTCAGAATTGTTTTTCAGTCGGATATATTTGCCTTCCATATCAACTTCTTCAATGCTCACATCCCCAGTGGCAGAGGCAGAATGAGCAATGCTGACACTACTGCTGGCCTCCGACTCTTCCACATCAATTCTCTTTCTTTTGCCTTTAGTTGTACGAACAGCGCGACTTGAAGAAGCCCTTGAGACAGTCACCCGTGAGGAAGGGCTGGGAGATAACTTCAGCCTCTCCTCTTCACCTTCCAGAAGTTTCCTGTATGCACTTTATTCCATGTCCNATGCCNATTTNACATCTAGAAGCTGCTCATAAATCATAAAGTTGTTGCTGCATTTGATCTCCTTATATCTGCCAATTTCTCGCTCCCCTTCCTGCAAGCCTATTTTAGAAAAGGGTTGGTCTCTTTTCCTC
Full Trace Sequence: GGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGATGGCGCAGTTTTTATTTCCAGACTTCTGCTGAGAGTAGAGAGATTCTTTAGCAGTCTCCTCAAATATTTCTTCTTCCTCCTCCAACTCCTCTTCAGGTATATTGGTGGTGTACACGGTTGTGCGCTGTGCTACTTCCTCTCCCTGAGAATTCTTCAGTGTGGCCTTCACATCTTCTCCTGTTCCCCATGAATTCTGGTTCTTCCAGATTAGGTCAGATGGTGGACTTGCTGTAACTCCAGCATCAGCAGCCCAGATTGTGACAGTCTGTCCTGCTTTAAGTACGTATCTTGAGGTAAACTTGAAATTCACAGACGCTTCTCCAATTGTTCTGGTGAGTTCCCAACCCCCCAAAGGCTGATCCTTCTCAGAATTGTTTTTCAGTCGGATATATTTGCCTTCCATATCAACTTCTTCAATGCTCACATCCCCAGTGGCAGAGGCAGAATGAGCAATGCTGACACTACTGCTGGCCTCCGACTCTTCCACATCAATTCTCTTTCTTTTGCCTTTAGTTGTACGAACAGCGCGACTTGAAGAAGCCCTTGAGACAGTCACCCGTGAGGAAGGGCTGGGAGATAACTTCAGCCTCTCCTCTTCACCTTCCAGAAGTTTCCTGTATGCACTTTATTCCATGTCCNATGCCNATTTNACATCTAGAAGCTGCTCATAAATCATAAAGTTGTTGCTGCATTTGATCTCCTTATATCTGCCAATTTCTCGCTCCCCTTCCTGCAAGCCTATTTTAGAAAAGGGTTGGTCTCTTTTCCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGATGGCGCAGTTTTTATTTC