ORFeome > LOC100036815 ORF1 – XORFeome v1.0

LOC100036815 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6466589
Gene Page ID:
ORF Xenbase ID: 17254305

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC128925
Original XGC clone length: 744

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ837862
dbEST ID: 79655564
Trimmed Sequence: ATGGCTTCCAGTGGCAAAATCGACTTGAATTCACCAACCATCACCTGGAAAGAGGCAAAAAGTTACTTAAAGGGCCTAAACAACAAGCAAAAGAGAGACCATTACAGCGTGAAAGATTTTATCAAATTGAAGCAAATCCCCGTCTGGAAAGACACTGCCAAAAAAGCGAACATCAAACAACCAGAGGAGGGAAAATATGCCAAGAACAAAGCTCTAAATGAAAAAGTATCACTTTTCAGGGGAGACATAACCAAACTAGAGGTTGATGCCATCATCAACACAGCTAACAGTTCTCTGCTGGGAGGTGGAGGAGTTGATGGATGCATACACAGAGCTGCTGGCCCTCTCTTGAAGCTGGAGTGCAGCTGTCTTGGTGGCTGCCAAACCGGTCTTGCCAAGATGACCTGTGGTTACCTACTGCCTGCCAAGTATGTGATTCACACAGTAGGACCAGTGGTGCAGGGGGACCTCGGATCTGCTCAGGAGGAAGAACTGAGGAACTGCTATCGGAACAGCATGTTAACTGCAGTCGAGGGCAAGCTCCGCTCCGTGGCTTTCCCTTGCATTTCCACCGGCGTGTTTGGGTATCCGCCCGAAAGCACCAGCTGATAATGGCCTTGAGAACATACGGGGAATTTCCGGAGGAAGTAAAAATAAATTTTGACCGTGTGATAATCTGCCTTCTTCTGGCAAAAAGAAAAGAAATTTATCTTCCAAAAACTTTCCCAATAATTTCCCTTTTGCCCTGCCCACCTTTTCTTTGACTAAATTGGGCGAATTAAAAAAAAAAAGAATTCCTAAAAACAATTTTGTTTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCCAGTGGCAAAATCGACTTGAATTCACCAACCATCACCTGGAAAGAGGCAAAAAGTTACTTAAAGGGCCTAAACAACAAGCAAAAGAGAGACCATTACAGCGTGAAAGATTTTATCAAATTGAAGCAAATCCCCGTCTGGAAAGACACTGCCAAAAAAGCGAACATCAAACAACCAGAGGAGGGAAAATATGCCAAGAACAAAGCTCTAAATGAAAAAGTATCACTTTTCAGGGGAGACATAACCAAACTAGAGGTTGATGCCATCATCAACACAGCTAACAGTTCTCTGCTGGGAGGTGGAGGAGTTGATGGATGCATACACAGAGCTGCTGGCCCTCTCTTGAAGCTGGAGTGCAGCTGTCTTGGTGGCTGCCAAACCGGTCTTGCCAAGATGACCTGTGGTTACCTACTGCCTGCCAAGTATGTGATTCACACAGTAGGACCAGTGGTGCAGGGGGACCTCGGATCTGCTCAGGAGGAAGAACTGAGGAACTGCTATCGGAACAGCATGTTAACTGCAGTCGAGGGCAAGCTCCGCTCCGTGGCTTTCCCTTGCATTTCCACCGGCGTGTTTGGGTATCCGCCCGAAAGCACCAGCTGATAATGGCCTTGAGAACATACGGGGAATTTCCGGAGGAAGTAAAAATAAATTTTGACCGTGTGATAATCTGCCTTCTTCTGGCAAAAAGAAAAGAAATTTATCTTCCAAAAACTTTCCCAATAATTTCCCTTTTGCCCTGCCCACCTTTTCTTTGACTAAATTGGGCGAATTAAAAAAAAAAAGAATTCCTAAAAACAATTTTGTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCCAGTGGCAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837861
dbEST ID: 79655563
Trimmed Sequence: GGCCAAAGGGAAATATTCTGGAAGCTTTTGGAGATAAATCTCTTCGTCTTTCTCCAGGAAGACGCAGATTATCACACGGTCAAACTTATCTTTATTTTCCTCCAGAAATTCCCGTATGGTCCTCAAGGCCATATCAGCTGCTGCTTTCGGCGGATACCCAAACACGCCGGTGGAAATGCAAGGGAAAGCCACGGAGCGGAGCTTGCCCTCGACTGCAGTTAACATGCTGTTCCGATAGCAGTTCCTCAGTTCTTCCTCCTGAGCAGATCCGAGGTCCCCCTGCACCACTGGTCCTACTGTGTGAATCACATACTTGGCAGGCAGTAGGTAACCACAGGTCATCTTGGCAAGACCGGTTTGGCAGCCACCAAGACAGCTGCACTCCAGCTTCAAGAGAGGGCCAGCAGCTCTGTGTATGCATCCATCAACTCCTCCACCTCCCAACAGAGAACTGTTAGCTGTGTTGATGATGGCATCAACCTCTAGTTTGGTTATGTCTCCCCTGAAAAATGATACTTTTTCATTTATAGCTTTGTTCTTGTCACATTTTCCCTCCTCTGGGTGTTTGATATTCGCTTTTTTGGCGGGGTCTTTCCAGACAGGGATTTGCTTCAATTTGATAAAATCTTTCACGCCTGTAAGGTGTCTCTTTTGCTTGTTGGTGAGGCCCTTTAAATACATTTTTGCCGCTTTTCGCGGGATGGGTGGTGGGTGCGAGTCCATATTGGCAATGGGAAGCGGGGGGGCTAGGGTGTTGTACTTGGTGGGCTTTAAGAAAAGCAATTGCTCGTCAGTTTGTGGCACGAAAGAATGCATAAGGATTAAAAATAAAATCTTTATTTTGGGGACAAAAAAAAAAAAAAAAAAAAAAATAAGAAAAAAAATAACAAAACGAAAAAAAAAGNGAAGAGNNNNNNNGNGNGGANNNNGGGGAGGNGGNGGGGGGGGGGTNTGGGGGNGNNTAGTGTGGGNNGGAAGAGNGGGGAGNGGGGGGGGAGGGAGANGAGGGGAGGAGGAGAGGAGGGGGAGGGGGGNGGGGGGAGGGGGGAGAANGGGGGGGAAGGNGGGGGGANNGAAAGAAAGAAAAAAGAAAAAAGAAAGAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAGAAAAAAAAAAGAAGAAAAATANANNNGGGAAGGAANGNAAGGGNNAGGGGGGGNNGGGAGGNAGGGAAGGGGGNGGGA
Full Trace Sequence: GGGGCGGGTAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCCAAAGGGAAATATTCTGGAAGCTTTTGGAGATAAATCTCTTCGTCTTTCTCCAGGAAGACGCAGATTATCACACGGTCAAACTTATCTTTATTTTCCTCCAGAAATTCCCGTATGGTCCTCAAGGCCATATCAGCTGCTGCTTTCGGCGGATACCCAAACACGCCGGTGGAAATGCAAGGGAAAGCCACGGAGCGGAGCTTGCCCTCGACTGCAGTTAACATGCTGTTCCGATAGCAGTTCCTCAGTTCTTCCTCCTGAGCAGATCCGAGGTCCCCCTGCACCACTGGTCCTACTGTGTGAATCACATACTTGGCAGGCAGTAGGTAACCACAGGTCATCTTGGCAAGACCGGTTTGGCAGCCACCAAGACAGCTGCACTCCAGCTTCAAGAGAGGGCCAGCAGCTCTGTGTATGCATCCATCAACTCCTCCACCTCCCAACAGAGAACTGTTAGCTGTGTTGATGATGGCATCAACCTCTAGTTTGGTTATGTCTCCCCTGAAAAATGATACTTTTTCATTTATAGCTTTGTTCTTGTCACATTTTCCCTCCTCTGGGTGTTTGATATTCGCTTTTTTGGCGGGGTCTTTCCAGACAGGGATTTGCTTCAATTTGATAAAATCTTTCACGCCTGTAAGGTGTCTCTTTTGCTTGTTGGTGAGGCCCTTTAAATACATTTTTGCCGCTTTTCGCGGGATGGGTGGTGGGTGCGAGTCCATATTGGCAATGGGAAGCGGGGGGGCTAGGGTGTTGTACTTGGTGGGCTTTAAGAAAAGCAATTGCTCGTCAGTTTGTGGCACGAAAGAATGCATAAGGATTAAAAATAAAATCTTTATTTTGGGGACAAAAAAAAAAAAAAAAAAAAAAATAAGAAAAAAAATAACAAAACGAAAAAAAAAGNGAAGAGNNNNNNNGNGNGGANNNNGGGGAGGNGGNGGGGGGGGGGTNTGGGGGNGNNTAGTGTGGGNNGGAAGAGNGGGGAGNGGGGGGGGAGGGAGANGAGGGGAGGAGGAGAGGAGGGGGAGGGGGGNGGGGGGAGGGGGGAGAANGGGGGGGAAGGNGGGGGGANNGAAAGAAAGAAAAAAGAAAAAAGAAAGAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAGAAAAAAAAAAGAAGAAAAATANANNNGGGAAGGAANGNAAGGGNNAGGGGGGGNNGGGAGGNAGGGAAGGGGGNGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCCAAAGGGAAATATTCTG